Description :
From Genome Similarity Track
Location :
contig_74:101382- 103221
Transcript NameFunction/comments
g10035.t1hypothetical protein

Sequence
1839 bases(100 bases per row)
GCTTTGGACCTGTTACGCAGTGGATATCGGATCGTGGGACTCATTTCAAGAACACCATTCTCGAGCAGGTGCGGAAGTTCTATGGTGGATCGCATCATTT
TACAACAGCATATCTAACGGGACAGTGGAGGTGGTGAACAGACTGCTACTACGGTGCATGCGGGCGATGCTGAGCGAGCTGAAACTGCATGCGCGGCGAA
TGGCCTACCATTCTCCCATTGGTGCAGTCTGCCCTCAACCAAATGCCAGCCGACCGGCTTGGTGGAGTGGCTCCAGTTACAGCGTTTACTGCGCTACCCG
CTTCGCCTCCCATTCATGCCATCCTGCACCCGCAGACACAAGTCCTCTTTGACGTGGAGGCCGTGTACGAGAAGCAACGCCAGCATCTAGCGGACATTCG
TGTCGCGCTAGACAACATGCATCGAGCAGTGACCAGTGTTGCAGAGACGAAGCGAGAGCAGGCAAGGGCACGACGAGCTGCACAATCGGGCGTGCACATG
GCAAACTTTGAAATTGGAGATTTCGTTCTTGTGGCTCAGGTGATTGGCCGCGTGAACAAGTTGGCCGTGCACTGGCGAGGTCCGCGGCGCATCGTCCGCG
CTCTCACAGACTACATTTTCGAGGTGCAGGATTTGAGCCCGCCGTTCCAAGTCTCCACGCACCATGCATCACGTTTACAGCTGTATGCAGACAGTCGTCG
CGACGTCACGGAGGATTTGATAGCTCATGCTATGCATGCGGACGGTGGTCATCTTGTTGCCAAATTCCTCAAATGCCGTCTCGGTGCTGAGTCTCACGTG
TGGGAGATCGAAGTCGAGTGGGTCGGGCTTGATCCGCTCGAAGCATCGTGGGAACCAGCGGCAATCATGTTCGAAGACGTTCCCCGACTGGTGGAACAGT
TCGTCAACTCGCAGCCTGATGACTCAGCAGCTCATGCTATGTGGTCGTCACTTGTCGACGAACGTCCGCGCAAACCCACGAAGAAAGGCAAAGGAGCCTC
CAAGAAGAGAGGGTAATGATCTGCAGCCATGCAGCAACGGTGTCGACCCGCCTCCGTCCGCCAATGGGCGGCAGCCAGCAGACAGCGAGTGGCAGAAGGC
TGAAGGTGACTCTGGGTTCTGGGTTGTGAGATCTCAGCCGGGCTGGAATATCATTTCTAGTTTGTACCCACCGAGGCGTCGCACTGCCACTGGCAGTCTG
CCAGTGCGGCACTGGGGAAGTTTGTAGTAGCGGCGCACCATGGCTAGCGTTAGAAGGAGGGCACGCAGTGCAGGCAAATTCTAACGGAGCTCAAATACAT
GTCAGTTTGAAATTTCCTCCCTAGTGCGCAATAGAGGAGGTGGCTGGGGCTAGCCGAGCGCCGAGCCAGAACACTCCTGGATATTGCAAGGGGATACTTG
CAGTATTGGCATACGTGAATCTCACGCTTATCAAACCAATGAGTCATGAATTTGTTGGCGCAAACGTCAACTGGTGACCACGAGAGCCTCTCGGCACAAC
CGAGTGTGGTGTGACTCATTCAGGTTTGTGCCGCCTACCCCGGGAGCGTCATGGCTCTCCACTCAAACCCCTTTTCAACTGACCGAGTTCCATTGGTGTC
CCCTGCGATGAAGACCGTCGCGGAGAAATCAATTGATTTTGTATTTGTTGCGGTTTACCATGCAATCTACTCTATGCCATTCTGCTACTGCTGCTCTCGC
CACGACAACCAATTGTCCAACGCTCACAGCCAGGCACTAACATCCGAGGAAGCAAGATCAAGAAGGCCAAGCGGGTGACTTTCGAGTCCAGCTTGATGAG
CTGTGGCTGCAACTCTCGGTGACCGCTCTTCAACAATGC