Description :
From Genome Similarity Track
Location :
Scaffold_37:101381- 105964
Sequence
4583 bases(100 bases per row)
TAGAGCGCGTTCACGGCGCTATGCCAAAGTCCAACGCATTTTCCTTAGGGACTACACGAAGCGGCTCGAGCTGATGGGCTTTATTCGACAAAATAACCAA
AGTCATTGGGCATGTGCAGCTGTGCCTGTGGCCAAACCCAAGTCACTAGGTGATTTCCGGATGACAGTCGACTATCGCCCTGTAAATGCACTGACCGTAC
CGATCGCTGGAGCAGCCCAGGATGTGACGGATTCTGCCGACGAAGCGGCCGGAGCTTACGGTTTCGCGGATTTCGACATGCCAAAGGGATTCTGGCAGCT
TCCTCTACATCCTGACAGCCAGGAGATAATGAGTTTTGTTACGACCGGTACTGTATGGACACCTACGCGCGTTCCACAGGGAGCGAGTGATTCGGCAACA
CATTTTCAGAACGAGATGCAAAAGGTTTTTGCCGGGATGCTGTACGCCCACCTACTTGTGTGGATTGACGATATTCTCGTCTATGCGGACGATGCGCCTA
CGTTTATCGCTACACTTCGTGAATTCTTTTCTATTGTCCGCACTCACCGGCTGAAACTCAGCGTGAGTAAGAGCTGTTTGTTTCAGAAGGAGATCCGTTG
GTGTGGCCGCATCTTCAGTGGCACTGGCATTCGCCATGACCCTGAACGCATTAGTGCGTTGCAAGCCCTTCCTCTCCCTACTACAGCCGCTGACCTCCAA
CAATTTTTGTGTGCTGCTGGGTGGATGCGCGATACGTTGCTCGACTTTGGCCGCACCATGCGCCCGTTGCATGACAAGTTGGAGGCGGTTTTATGTGTTA
ATGGGCGAACTAAGAAACTAGCAGCCGGGGTGTTTCTTTCGTGGACTTTGGACGAAGAAGACGTGTTCAACTCCGCAAAAACCCTGCTTGGATCCTCGTA
ACTGTTGCATTTTCCGACGACGTCGTCCACAGTGGCCGTGTTTAGTGACGCCAGTGAACTGGGGTGGGGGCTCGTCGTGACTCAAGTGGATGACTGGGAC
TCTGCATTACCTGCTAACGAGCAGCAGCACCAACTTCTAGTATGCAAAAGCGGAATTTTCGACGAGACGGAACGTCGGTGGAGCATCATTGAGAAGGAAG
CGTACCCGATCATTTGGGCTGCCCGCAACCTGGGCCATCTTCTCGTCCGTTCTTCAGGCTTCAGGCTGTTCTGCGACCACAAGAACCTGATCTACGTGTT
CGCACCAACACACGAAGTTAAACGTCACGTGCGTGGCAAATTACAACGGTGGGCGTTATCTCTCACTGGTCTTCACTACCAAATCGACCACATCGATGGT
ACGGCGAACGTGTGGGCCGATCTACTCTCGCGGTGGGGTTCTTGTGGTGAGGCAGGGGTGCACGTGAAGTGCAAATTCGTCACGCGTAGCCAGCAACGCA
TTGACGACGCGACTGAACGCCAACTTGACGAGCTGCGTCCGCGTCAAGGCGACTTTGTCTTTCCGACCTTGAATGAGATCAGCCAAGTGCAACAGCAACA
CAAGCGGAATGCACCCAGAGCAACGGTGTGCGATCACAATGGCATCATGACTGTCGACGGAAAAATATGGATACCAGAGTCCGTGAAGGAGCTACGACAG
CGCATTCTCATTGTGGCTCATCGCGGTAGTCAAGGACACCATGGACTTGACGCGATGATGACTACAGTCAAAGACCTTTTCTCGATCAAAGGCCTGGAAC
AACATTGCCGGCAATTCCTGAAACGATGCCTTCTCTGCAAACACGTGAAAGGTGGTAATGTGATTCCACTCCCCTGGGGACCTACATACGACGCATCTGA
GCGAAACGAGATGCTCCACTGGGATTTTCTTTTTCTTGGTGACAGTGTGGGTGAATGCAAGTACCTACTCGTAATGAAGGACGGCCTTACTCATTTTTGT
GAATTGGTGGCTTGCGATTCGCCAACAAGTGTCGTGGCAGCCATTTCACTCATGGATTGGTCGAAGCGTTTTGGTCCGCCTAAAAATTTGATTTCCGATC
AAGGAAGCCATTTCAAGAACCAGGTTGTACAGCAACTTTGCAAACAGCCCTCCATTGAACAGGATCTAGCTCTAGCCTACGCTCCGTGGATCAACGGTAC
TATCGAGCGACTGAATCGAGATGTGCTGCAAGTTCTACGTGTTCTGCTGATGGAGATGAAGCTGGACACGCATGAGTGGGAATATCTCGTTCCGGTAGTG
CAAGGGATTCTGAATCACACTCCAGTGGCTTCATTAGGCAACCGGTCCCCTGGTGAGCTTTTCACCGCGTTACCTAGACCTACACCATTTGAGACTATCG
TAGTTGAGCGCAACGGCAAGGCCATGATGGTGACTGAGCCGGTGACTATTCCTGACGAAATGGTGGAGAACATGCAACGAAGTCTACAAGAAATGCACAA
GGAGGTGGTGGACATTCGGGAGCGACGTCGGTTGCAGAACATGAGCCGCTCTAATGGAGTACCATGCAATTTCACTATCGGTGATTTCGTACTGTGGTCA
AGGATCGACTCTCGCCTTTCGGTAAACAAACTACTCGCTCGCTGGGTGGGACCATTCGAAGTTGTCGAGGAGCACCCTCATTCCTATATGATTCGCCACT
TGGTGAGTAGCCAACGCTACATGGTGCATATATCCCGGCTCAAGTTCTACCGTGACGGAAGCCTGGGCACCAGCGAGGAACTCCTGGCCCATGTCGGCAA
CCAAGGTATGGTCCTTGGCGTCGAAGATTTTAAGGATCACCGCAAGACCCAACATGGATGGCAGCTTCTCGTGTCCTGGGTCGGTTTGCAGGACGAAGAA
GACTCCTGGGAATCTCTTCAGAGTCTCTACAGTGATATACCTACGCGTGTGGAGAATTACGCAGCTCAAAGTGGCGACAACGAGTTTGTACAGGCCTTGT
CGACCTTTCAGCAAAGTACCAGAGCCTAATTCGACGTGTAGGTCAAGTTATGGACCAACTTCAACGTGTTGCAGTGCAACTTGACCTGTAACACTGTCCC
GTCTCATGTATGGACTGTTTTTTCGCAACCGGTGACAGATTTCCATCAGTCGTGACATTTGGTGACATATGTCTTTCTGACTTGGATTTTCTATACTTGG
AGAATTTTCAATACAAGAGGCTCAACATTCATATCTGCATATCAAGACGGTACTGGTATGGGTTCTTCGGGGGCAGTGTAGTGTGTGGCAAGCGAGGAGG
CGTACCTCAACGGCAAGGAGGCTATCCTGAATCAAGAACCCCATCCCAAACTACAGCGTCGTCTATCAACATGAGGTTGCAGTCTTACTGCAACCCTGGT
GCTCGACTCTCAAGGCTGTGCCTAGGGTGAAGCCTTTGGTCCTGATAGGAGTAGGAGGAGTCGAGTAGAACGCAGGAGCAGGAGTTAGTCAAAAGGAAGC
TCACTTCTTAACTTGCAATCAACAAGCACCAGCATTTCAGCAACGCAAAGCGGTAACTACCACATCCTTCAACACGGCGCTATTGCCCATCTCCCAGGTC
ACGACGGTGTCACGCCACTCCAGCTCATCATACGCGGTCACGACGTCGGCATCCTGCAGATCCTGCTCAACCGCCACCTGCGCGTAGTGACAACTGAAGG
AGAAGACTTTGCCGGCTCTGTCCTGATGACTGCAGTCGATGAAGGTGCGCTGCCTACTGTCAAGTTCTTGTTGGAAGAAGAATACGCGACCACAGCGCAC
CAGAACTGTAAGGGGGAGACGCCCATGCACCAAGCGATATTGAAGAGAAAATCTGCAGTCGCCAAACTCCTGCGATCTTCTGACGAACAGACTCAAGTTT
TGACCTTGAACACGACGTCGGGAGAGTCATGTCTCCACTATGCTGCGCGGTATTTCACTCCCGAGGAGCTGCATTGTTTGTTGCGCTTTTATCAGCGTCA
TGAGGGAGTCGGGGGAGAGGGGCGTGCACTGTGGAACAGTGTTAACTCGGCCGGTACGACGGCGTTGTTCCTGGTCGCCACGTCAGCGTCGGACTCGCTT
GACGACCGCAATGCAAAGACACGGCTAATGTTCCGTGCCGACGCCAAACTTTTGGGAAGTCATCCGTTCTTCGAGACTGCACCGAAAGAGGATTTACCAT
CGATCATGGCGCTCTCCGATGAGGTTCAAACTTGTCTGAGCTTGTGGTTGTCGGAGTGTGCGGAGACTCGTTTGGACGAGGTCACCCGGTTCTGTATGAA
GTTCTGGGCGATCGTGTACTCGTTGCACCATCCACTTCAGGAAATAAGCCACGAGGTGCTTGGGGTCATGTTGTCATCGGGCCAAGCCGTCGACACGATA
CCTCTGCTGTTATCGCTGCCATTCGATCGACGGGCGTCGATGGCTTTATTAGAGCTCGTTGGAGTGTTCGGCAGAGAAGAAAACCATTCGCTTATACTGG
CACTGTACGAAGAACTCGCTGCAGCTTGGACAGGACTGGTTGCATAGCCAAGAGGATGGATTTGCCCGAATTTGATAGTTTTAGTTGCTGTGAGTTTTAT
TGGCTCGAGGTACCCAGATTAAGAAATATTCAGAGTCTTATTAAGAAAAATACCCTTATTAATTGCTTGGAGATTAAACGCAC