Description :
From Genome Similarity Track
Location :
Scaffold_642:10138- 17426
Transcript NameFunction/comments
Phyag_g7222hypothetical protein PHYSODRAFT_294124
Phyag_g7223hypothetical protein
Phyag_g7224conserved hypothetical protein
Phyag_g7225hypothetical protein PHYSODRAFT_248209
Phyag_g7226conserved hypothetical protein

Sequence
7288 bases(100 bases per row)
CCGCGTCGGAGTTGATTCtcagtgctgctggcaagTGAACCCCATGCGAATGGGAGCACTCTGGCTGCATCTCACTGATATACGATGCTGCACATGTGAG
ATACGATGGCCACCACAGCGCATTCAACGCATTGCTCGATGGTTGGGCGTGTGGGCAGGAGGAGCGCGATAATTCGATGCAAGGGCTGCTATCATCCTCA
CCCGCCTGATGGTGTGGACATGCGAGTATTAAGACGACACTGAACCTTGGAGATTCAGCTAATGTACCTTTGTACCCATACCCGTTGCCAAAAGAACGCA
ATGCAGGACGTGTGAGATTGAGCTGggctcaagcagctcgaTCCAGCTCAATCCAGCCGTCGCTTTTTTCTGAGGCGGCTGTATGTAGCGTGCAAGCTGT
TGGCAACTCGTGTCACTACCGAGAGTGCATAGCTGCAGCCAACTGCTGTCCACTGCTGGTTTTCTGAGCTGTGCCCAACGCTCTCTGTTCCATTCCTGCT
TATCCTAGCAGCAGAGCACATCGCTGTCCGCGTCAGCATAACGTCGGTCTTTTCATCACTCGTCGATTTGCAGAGATTCGAGAGAGACACCGCACCGGCG
AACAGGAGTAACCAACCTCAACGACATGCCTGCTCTCACCGTGGACGAATTGGCCATTGACGAGCATcagctcgtggcgctgcacgtgGCCGAGTCGTTC
GCACACCGCCCCATGTCCTTCGACGACGCGCTGTGGCGTTCACGCAACAAGTCTCTGCGTGGCCGCAGCTCCATGCCGGCCGCGTTCAGTATGTCGTCGG
ATTTCGGTTCCTCCCGCCTCTCGAGCTTTGGGTTCATCCCTGGCCACGAGATCATCGAAACCAGCGTCCGCTTCTTGGGCGTGACCCGCGTCAACACCCA
CTGCGTGTTCAAGTTGCTCGTTGATACCGGCAGggagcagttcgagctgcagaagcgctACTCGCAATTCCGCGACCTGCGTCTGCAATTGCTACTGAAT
GCAAAGTTTGCCGGCGTTGCTGGCGAGGAGAAACGCGAGGGCGAGTGCCGCAACGGAGCTTGTCAGCAGCTCACACAACAGCTTGCCATGCTCAAATTCC
CGCGCCGTAGGATGAAATTCAAGGTGCaccgtgacgacgacatcaagacTGCGAGAGAACGACAAAGTCAGTTGCAACAGTTCGTCGAGATGTTGCTGGC
AGTGTACCGCACAGCGTCGAAGCGCCAGGTGCGATGCTGCGTCAATTCGCAGTGCCGCGTGCTTAAGGCTATCAGGTCCTTCTTGGATATCAAGGACCTG
GGTGAAGACGAGCTAGCTGACTGGAAGTCGGTTAGCAATGGTACTACCAGTGGCGAGGAAGTTCCGATCCTTGATACTCCACCGTCATCGGCGTCGCCAG
TCAACTGTGCTGTGGTTTCGGACGTGTCGCCGATGCCATCGAGAACGTCGGCTATGTGCTTGGAGGAGCTGTACACGATCACCGAAGACACGGAGAACCC
CCACGTCTAGACGATGTGGTACTGAACGACGTACGGACGATTGGCAGTCCCAACGTCTTCAACTACTAGTAACTTATTATCAGCTCAAAAATCCAATGCG
TGTTAGTCATTGTAGCACCAACTCGCTTCatcggagaagaagatgaagcgaGCATATTTGTTCGTGATGTCAACATGAAAATCTTCAATGTCCTTTTGTC
TTAAACAGCTCTACGATAGCTGTGGAGACttgatcgtcttcgttgCGAAGCCCACCCATGATCCGCGAGGTCTTACCCCACTGGACATTGCTGGTGAGTG
CCTGTAGCCAGCGAAACACACGTTGATTAATTCCAAGGCAACTCAACTCAACTGACGACTGGGTTGCAATGAGTTTACAATGTACCTGATCATTCTTTTT
GTCAGCACCATCCAGACGCGTATTgtcgtcagctccagcgcgttgTCGCGCCCACTGCAAAACATACAATCAGAAACAAGTGAGCCTCTCAAACACGAAT
GATTCCGTCTCATTCAATACTTACCCTGAGCCAATTGCCATCGCTTCCATGCATACGGCGTGGAGACGGCTTGGAGTTGTCGAGAAGTGGTTTCTGGACT
CGTCGTAGCCGACCAGTGGAGACACCTGGAACCCCTCGCTCGGTTTGTGAACCTCTGCTAGAACTTCGCGAAGTCGGAAGTTTTGGTAGGCAAAAGTTTG
GCTCACGCGCTGAACGATGGCCACCAAGGTCTGGCCGTGGCCCCATGATTGGAACGTGCTCTGCCTCATGTCTAGTGCGAACCGAGTCCACCAGCTCGTG
TTTGTACTGGTTCCATTTGGTCTCCCGTTTTAAGTCATTCTTCACGTTGGACGTGTCGGCGCGAGCAGAGAGTCCGACAACTTCCTGGCGAAACAATTGC
TCGGTCGTGACATCTTTCTGCACAATTTGTCGGAAGTCCACGCGGTCGACGCGGTACAGCACGGCCGAAGGTGACGAAACCAGCACAGAAAACACTGCAT
TGGGCACACCAAGGATTGCCTCGTAGAAGCCGAAATAATGTTGGCTTTGCAAAGAGTAGGGAATACATTGTTCGTCAGTACTTTTCGGGCCTGGAAGTAG
CAATATTCCATACAGTAGCAAACCTGCCAACAGTAGATATTTCAACGAAGCACTGTTGTCTGCGAtcgctctgcttcttctgctccagtGCTGAATAGCG
CTTGACAAGCCTGCACTCTCCGCTTTTGACAAAGTAGAAATTATCTTCATGTGGAATGAGCAAAGTTACGATCACTGAAAACTGAACAGTAGTTTTACGT
ACTTGCAGGCTCgccttcgacgacgatgacatCGTTGTATGTGTGCTGGATCTTCTCCATTCGGTTGCAAAGCTTTAAAATGCCTTCGTCTTCCCAATGA
TCCAAGCACGCCACACCCGCCAAGAAGGTCATTTTCTCGCTAAACAGACGGGCAATTAGACTAAATGTCTGCTGAATGAATGAAAACAACACGTACCGGA
GCTCTCGCGAGAGGTTGCAAGCTCGAAGCGCCATGAACGTGTCGCGATCGATCTGCATGAGTAATGTCGTCTCGGTGGCCACCACAGAAGCCGTACGTTG
TTGCTCCTCGAGCAGTAACCCAACGTCCCCGAATACTTCTAGCGGCTTCATGGTGCGAACGACATACGTTGCGTCATGCGACATATCGAGCTTGCCTCCG
GGGTTCAGGAAGCTCGAATGCACTCGTGCGCGATTCATGATCTCCTCGAACTCGTTTAAAGTGGGTGCTGCCATGCGTGAAAAGTCCATGACCACGCTCA
TGGTGCCGTACATGATGCAATAGAAGGCATCGGCTCGATCTCCTATCCGGAACagagcgtctccatcgtccaACTCGATGCCTTTAGCTGCCTTCAAGAA
CCGCAACCGGTCTCTCGATGGCAGATCCCGGAAGTATTTGACTTGGTGGACTGGTTAGACAAACAAAACGCCGTGTCAAAGCACGAATTGTCAAAGTTTA
CTAAAAACGACAACATCAGTGTGGAATTTGCAACGTACTGTAGTTCTCCAGAAACTCATAGTCGGCCTTACATCTTGCAAACTCCGACAGAAGCAGAATT
CGGCTCAAGTTGGCTCGCACTTCCGGCTGCTCGTGGATGGGGGGTTCCTGCCAGCTCGGCCTCTTCGACAGCCTAACAATTACAATAGAAAACAACCGCA
GTGTTAATGGAAGTACAAGTTGGATTGACGAGAAAACTCGCACATGCTGCGTGGAGCTTGACGAGTTTAGCTAGAGACACGACATTGAAGtcaaatgtag
ccatttctaAATATGGCTACATCTATCTCAATGTACGCCACACTATTttacaaaaaacaaaaaatcGAGTGAAGGCTCGAAAGGTGAGGGTGCGTAGCGT
CCACATCAGCGGTCTTAATGCTAGTGCACACGCTCCCCCACTTCATGAAGCCCTGCCCCTATATAGATCTATATCTCACCTACCTATCCATGTAATTTTC
ACGCAGGTAGCCGCCTTCGAATCGCTGTTAAACGCTCCCTACTATGGACCCCGAAAACAGGAAAAAGTGTACTGACGTCGTGGAGCATTTCTTCAAGCTA
GATAGCTGCGGTGAGTGGCACATTCTATTGACATTTTAATCTTAAATTTTGTCGAGTGGATGGCAATAAAAACTGACGTCAATGGTTGCCACTGTAGAGC
CCTTCCGCGAGCGTGTCAACTGGGAGGAATGGGGACTGTACGACTATCTGcaggtggtgaaggagccTATGGACCTGGGCACCATCCGCAGCAAACTGAG
TAAGAACGAGTACAAGAAGCCGTCGGAGTTTGCGCGCGATATGCGTCTGGTCTGGGACAACTGCAAGCTCTACAACCAGGACGGGTCCGACCTATATCTG
CTGGCCGATGAGCTCGCCAAGAAGTTTGAGGACCGCGTCAAGAGCGTCAAGCTCGATGTGGGTCCGGTGCCCAAGGCTGACAAGAGCATCCCGTACGGTG
CATGTGCTGTGCTGTCTTTATTGCTCTTAAGGATGAGCTGATGCGTTGTGTtatgttgctgctgctgaacagAGCTCCGAGCTTGGAGAACAAGGTCCAT
TTCAGCCAGAACATTTACAAGGTCGCGCCTAAAGACTTGGGTGCTAttgtgcagctgctggaggagcagtgtccgaaggcgctggacaagagcTCgccgg
acgagctggatATCATCGTTGATCACATCGACAACAAGACGTTCCGTGACCTGGAGAAAttcgtgctggagaaggtgccCGAGGGTAGTCGCGAGCCGAT
TTCCACGCccaagtcgtcgaagaaATCTCGACGGCCtccgaccaagaagaccaaaACCGACGCGTAATCGATGATGAGTTCGTTTTGAGCCTACCAGATT
CCTAGCTTGACTTGCCGTACAGTGTATGCCATCAACGTTTTGAATGACCGCATCCAGGCACGCAATGAACATTTGACCCTCGATTTCCTGGCGGGTCGTT
AGGGTATTTAGTCAATTCATTTACGCTTTCTTACGAAGCATAGCTGCAAGCCGCGTCTGGCGTTGGAACGTGGCCTCAaagctcttcctcttctgtTTTT
GCGCTGGTTTATCGGGTTTTCCTTCAGGAGAGACACCAATGGTGGGTTTACCTGCTAGCTTGGTCAAGTCTAGTGGCGGCACAACCATCGGTGGCGATAT
CTCGTCTTCGTCTACTGGTGTTTCACACTGGgtagaagctgctgctgaaagtCGTGATCCAGCCCTGGCGCGAGTAGATTGCCACTGCGTTGGAATCGCT
TTAGGTCTATTGGTTATTGCACCGATTCCTTGCGCAGCACCTGGATGTGGAGCCactggctgcagcttcaacagtgGAAGATTAAACGTTGACGATCGTC
GAATTGCTTGTTGTTCTCGAGAAGGCCGACGACTCGATTCGGGTCGATTGTGGAGCGAACGTTTATACTCTAGCAGCTCTTCCTTGTGGAGCTCCATTAG
CTCTCTACAATAGTCATCAGTATACAAACGCATAATTGAGACTCTGCCTAGCAGGAATCGGAGACAATTTGCACATTTTACCTGAGTGACGGCTCGTCAC
CCTCGGAAGCATTCCAATTGTCACCATGAACCTTCTTACCAGCTTTCATGAGTCTTGTCCATTCCTGCAGTACGAGGAGGACGTAACCAAGATATCCAAT
ATGGATAAATGCTAAAAAGTGATGAAAATTTACCTCCTCATCACGCCGACTTGTTTCCACTCGAGAAGTCACGATTTCCTCAAGCTCGTCGTGGTAGCGC
AACTGATCTTCTCTAGCTGCAAGCTGTTCTTTGAGTTTGCCAATATACCGCCGAAGGTCCTCTTTGCGCTTGCCAATCTGTTCGAGCACACCTTGACTCG
actgttgaagttgcagtggcGGGTGATATTCTACACAAACGTCAGACTCGGTCAGCGGACTGACTCACTGGATGAGGAGCAATGGATAAATTACTTTTCC
GCCGCTCGCGTTTGCGCAtctgttgctggaagacTCCCAGAGCGAataccaccaccaacacacAGCCGATGATCAACCCTGGCACGGTGATCGTCAGGCC
CCCTGTTCCTCGACTCGTGGCTCGAATATTCGGCATGTCACTTGATCAGCTGCACGATCCTGACGTTGGTGCATGCACTGAGTGCTTCAAGTCACAAAGT
TTTGACAAGACTGAACCGAGTCACACGAGCCATACATCCTGTATTTTTAGCGAAGGAAAAATCCTCCTTCTCTAAACAGCAGAATATGCGCATGTATTTA
TACTGCGTGGGGCCTAGTAGCTAATCttacaacagcaacaataaaTAGGAGAACGCTCAGTCGCTCACACGTCGGCAACGAacacgtcttcatccacagc
AAACGCCGACGCGTCGAAGCTCGCAGGCGGTTGATCTGCTGGCATGGGGATGAGCCACGAGTCGCTGAAGTCCAGGTGGTCCCAGCTCTCCCCGACGTCT
ACGGGGGATGTTTTGCCCTCGGGCAGCGCCGCCAACACCTCCAGTCCGTCCAGGTTCTTGCTGACGTCTCTCTGAGCGTCCTGACTCAAAATGCGATCCA
ATGCTTCATCATCCACCACCGCGTCAGaaagacgctgcagctccatcgaggGCATTAAAGATGCAGTAGccgttggctgctgctcctccgttTTGCCCTG
GAACCCCGCACGGTCGTAGacgccgtcgagcagcacAAGATCCTGCAGGAACCAGCTGCTGAGGGCGGCCTCCTGCGCccgctgcttggccagcgcctcc
tccttcatggCCACGTGGGCACTGAGCGGGGCGCGGCGTGCGCGTTGACGCGGCTTCTTGTGGGTACGGAGACGTTTGTCAGCGACTGGTTCCAAATCTG
AGGAGGCCTGTGCACGCGCCTTGCGCTTCAGCTCAAGACGACGTTGGTTCTTGTTGGCTTTTTGGCGATGGAAGTCGCAGAGGTTGTGACGCTCCCCGTT
GCGCTTGAGCGCGCGTGGATTCCAACACTTTTTGCTGGGATAGCGACACATGACCTCGGTATCGTGCACAGGTTGCTCTGTTGCGGTGGGGGAGGAAGGG
GGAGAGGAAGACAAAGCTGTGTCGTTTGGAGTGGTGGACATTATGACGTGGGGAGCGACTGGAGCGGAGCAAAAGCGCGAATGGCCGCAGCCGCGAGCCA
CGCACGTTTGGTTTGGCCGGGAAAAGTctgttgctggaagataCCAACTGCTCTCCCCCATCGGATCCGATAGCTACATGGGTGAATT