Description :
From Genome Similarity Track
Location :
Scaffold_14:101356- 103869
Transcript NameFunction/comments
g1159.t1XP_009517795.1 hypothetical protein PHYSODRAFT_466776 [Phytophthora sojae
g1160.t1hypothetical protein
g1161.t1hypothetical protein

Sequence
2513 bases(100 bases per row)
TTACTCGATGGCGTGGATATCGTAGCGCTGGTTGTCCCATTTGAAGTCGCCGATCACGATAGCATTCACGTCTTGATCTTCGCCAACGTCATCTGGGAAG
TCGGGGACGTCGATGTGCTTGCCGAGCTCCACGGCGAGTTGAGATCGCACGAGCGCAATACCCTCGCTTGTTCCAGCAGCGACGTGTTTGGTCTTCACGT
CGTGGTACAACCTCCCAGTCGAGAGGGAAATCCGCAGCGACGCCGGCAGGAAGGGCATCGTCAGCTCCCCACCACCGAACACGAGCGTCCACTCGCCGTG
GTCATCTTGGTGAAGATCCTCGAACACAAATGGGCGGTCGGCACACTTGATAAAGTTCATCTCCTTGCCGCAAGGCGATCGGAACGGGTACTCGAGAAAT
TCCTCCTCCGACTTGCACTGCGCAATGCCATTCGGCCGCACCTGCGAGAAGAAGAAGCGCAGGAACTTGGCGCTCTTCAGGGATGTGGCAATGTTCTTCG
GGCGTGTGTCTTCAAGAAACAGACGACCCTGTCCACACACAGCAGCCCGGAAACTTCATCAACTCACTGCAACTCCCCCCCCACACACACAACAACGAGA
GAAAAATCGACCCCCACCTGCAGATCAACGTAATAAAAGTATCTTCGCTTCTGGCCTTGCAAGTCGTAGAACTCTTCACTATACACAGCAAAAATGAAAG
CTGAACGCGTTAGCAAAGAGGGGGTTTAGTGCCCTCTCAATAGACAGGAGCCTTTCCACCGAACCTCTTGATGTCTTTCAGCTGCTTGAGTTCCAGGTAC
TTGTCCTCGTCCGCTGTGCAGAGCCCTCGCAGCCCGTTGGGTGCACGACGCCACGCCCTAGACAAAGGCCTCAAATGCCGACGCAGGTACGAGCTCATGG
CGAGAGGTGCGTCACTAAACTGTCACTATTGCCAAGAAACGCCACTTCAACTAATCGGAATGGCGGCGAGCAGCGGCGATTGGGAGTCTATTACACCCTC
CTTCCGCTCGAATGGCGGCCGCAATAGCATTATCAGCTTTGGAGAAGGGAAAGGATACGCGTTGAGATCTCTGGGCACGGACGCGAGGGTGCGTGGCGCG
GATACACGTCGGCGAGGGAACTCCGAAGGAGGGACGGCGAGTCGCATGTTTTCCTTGACCACGCCTCTGGTTGCTCGGCCGCCTCCGAGACCGCCGCTGG
ATAGAAACTTGGTGTCTGAAAAGTGTGTGGCGATGGCCCAGCGCACGCAGGAATTGCTGTTCGACGCGAGGGAACTTGACACTGCGATGGAGGATATGAT
CTTGTGGGTGCATGCTCGCGTCGTGCCGATGAAGTGGCGCCGTCAGGTTTTGACTCATCTAGACCCCATCTATCGCCAACTGACATTCTGCCGGGAAGAG
CTCGTACGAGGGTGGAAGTTGCTGCATCCGCCATTTTGCCAGCCCAATCTCGACTCGTACGAGCGTCGACTTGGCTTCTTTCAACGATCGGTGGACCTAC
TCTCGGCGGCTATGGAGGAGTGCAAGACCAAACTACTGAACGCAGAGGCTCTCGCGGCATGCAGATACATCCAGCTATGGACGCGTCGACTGCTGGCAAA
GGTACAATACCTGGCACCCCGTTTAATAAATGCACGATGGAGTGTTATTGACCATCATGTTTTGTGCACTTGACAGCGTGGGTTCTACACAAAGCTGATC
AAACTGTCCTATCATCATCGTGGCATAGTGTCCGGCATGTTCGACTCAATCCCTGGTAACTCCAAGTTGACAGCCCACCGACATGACCAGCACGTGACGC
TGGAATACCCTCGCTCCGAGAGGAACTGGGACAGCTTTGGCCAGCACTGATACCTCATCGAGGCGAAGCCTTGGCGGCGTGATCGTCAAAAGGCCGACAA
CCTACTCGTAGATTTTCGCAATACTGCGCAATATATATATTGTGTTACTTTTCGCGGATCAACCGACTACATGTAGCTCAGGTTGCGATGTGAGCAAGCA
AAGCGCAAAAAAAGACGTAGGGCGGAACCACCGGCACGAAGTGACTTAATGACGGATCCCTGCGCCGATCTGTTTCCGCTCGTGTCGACCTTCTCTGAAG
CTCCGACCGCTTATCTCTTGACGCTCTTGTTTTCCTCCTTTTCAAACAGGTCGTCGAACTGGCGAGACTGGTTGATCGGGTTGCGCTTGAGGTTCGCCAT
GCGGAAACGGAACTGCCTCCACGATGACCCGCGGTCCTCGCGTGGCTCCAGCGTGTGGTGCAGCGTCGTGAAGCGCTCCTCCTTGTTCACGTACACGTCG
GGGTTCTGGAAGAGGTAGCGCAGCGACATGCCCGTGGCAGCCACGGCGGCAAAGGTGGCACAGAAGACGACGGGGAAGGTGCCCTTGTCCGTGGTCCAGA
GGTTGAGCAGCTTGTAGCCCTGACGTTTGATGACTTGAACCATGTTTTGGATGCAGCGGGGGGAGGGAGGTGAGGGGGTCTGTGCACTCACGCGAGAGGA
ACTTGGGGAATGA