Description :
From Genome Similarity Track
Location :
Scaffold_42:101351- 105425
Transcript NameFunction/comments
Physo_135962reverse transcriptase
Physo_135963hypothetical protein
Physo_135964reverse transcriptase
Physo_135965hypothetical protein

Sequence
4074 bases(100 bases per row)
AGATCGAAGGAACTGGGTACAAGTTGTATCCTTGGGTCCACATAAGTCGACTCAAGCCGCGTGCCCTGTTCCCGGAACGACCTACAGTTGAGGTTGAAGT
CGCTGAGGATGATGATCTAGACGCAGCTCTGTTGCCTGAGGATGCTGAAGAACCCGATGAAGCTCAGAATGTGTACGAACTGGAGGCCATCCAGGATGTA
CGCTGGGTTAAGCGGACCCGAACTTCACGGAGAGTCCGAGAGTACTTGGTCAAGTGGAAGGGGTATCCTGACACTGAGTGGCTTCCCATGTCTCAGCTAA
GTTGTGGAGCTTTGCTGTATGAGTTCAACAAGAGCGCCAAGGCGAAAGCACGGTTCCAAGCAATGCAAGCTGGGGATGAACCTCCTGAGCCCGATGCTCA
ATAGAGGCACCTCAGCTGTGAACCTGTGTATATCGCTGTGACGTTCTATGTGTGAACCCTTCGTATTATGTGAATTTACGACTATGCTACGTGATGTGGA
GACTGACTTGGAGTTTATCGTGGAGAACAGTGGATGAGTGCGACGTGAACGCGCGCCGAGGACCTGAGATAAATGGGAAGGAGACGAGAAGTACCAAAAC
GAGTGGTGAATTAGAAATAGCGATGAAAGCTCGTTGCCTACGCTTTCTCAGTCTCCTTGTCTTGCACGGCTTCCAGAGCGCGAAGCACCTCAGCAAGCGT
GTCGTGGTTGTACTCCGGTGCTGGGATAATTGGGTTCGCCTCCCGCTCGGCTCTGCTCTTGGACTTGAGCTCAGGCGGGACGATCGCTTCAAACTGCTTG
TCCGAGCGGCGGGTAGCCCATTGCGTGCGAACTGGTTCTTGACCGTCCAGGGTGAAGAGTTGGTCAGCCAGCGAGATCTTGAGATCTGGGTCTCGGAGAA
TCCAGTGGCACGGATCATTGGGCACAGCCCAGAGTCCGGGCTCGAACCAGATCCGGTCCGAGTAACCCTTAACGCCCCTGAGCTGGTCGATCAAGTCCCT
GCGACGAAGCTCGAACTCTTGGGCGCGGTCCTTGCGCTCTCGGTAGACGGTGGCCAGCTCAGGCAGGCCCAGTTCCTTGGCGAGCTGAACGTAGTCGATC
TTGGACGGGAACGGATACCAGTGGAGTCGCTCCCAATACGCTCGACGCCAAGCACTCATAAACCCAGCAATTACAACGACCGCTTCGCACATCTCAGGAG
TGATTTCCGCATGCGTGTGGTAGACGAGGAAGTCAACTCGGCCATCCCACATGTCGTCCCAGGGGTCTGATCTGAGCAGCTCCAGATAATACGCGTACTC
GATGCGATTGTGGAGCTGCTCGATCCCAGTCTTGGATGGCATGTAAGCTGGGAAACCAATCGTCTGATGGTGCAGCTTCTGGACTCGGATGCCGTTGTGA
AACCAGCTGCCTTTCTTGGGGGCCTTGATGATGCCATTATCGACACCCTCCTCAGGAGTCTCAGCATCGTCTGGCTCAGGGTCAGCTGAGGTCACGGAGG
TCCCTGAGGCTGAGCGCTGGCGCTTGGTCACTGAGCTGCCCCCAGAAGACGTCGAACTCCGCTGTCGCTTCTTGTCTGCTGGAGAACTCTGAGATCTGGT
GCTGATGGAGCTGGGAGCCTTGGCCTTCGACCCGTAGTAACTCTGGTCACCGTCGCTGTCATCGGTGTCCTCTGAGGATAGTACAGACATGAACGAGGAA
TCCGAGTCATAGTCGCTTGCGCTTGGTTTCTTGGGCAGGGTCCGCCAGGGCGCTGGGATTCTTGTCAGGCCGGGAGCCGGGAGTCTGGTCACAGCTGCAT
CGAAGTACTTGTCGGGGACATACTGCATCCACGGAGTGTCGTCCAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCT
GCAAGAGGCTGAGCCTTGGACGAAGAAGCTCAAGGATTATCTGAATGGAGACTTGGGGAACCTCTCCGCTACTGAAGCTGAAGATGTGGTCAAGATGATG
GATCAGTTCACCCTTGATTCGAGAGGAGTCCTGTACTATCTGAGTCGAGCTACTCCGGTAAGGCCTAGAGACGCAGTTGGGAATCTGAGATTGGTTGTGC
CAACGGCGCTGAGAGATGACTTGCTTCAGCTCAGCCATGAGGAGTTCCAAGGTGGTCATTAAGGGATCACTAGGACCTTCGAACGACTGCGCAGGGAGTA
CTACTGGCCGAGGATGTACGCGGATCTGGAACGCTATGTGAAGGAATGTGTGGATTGTGTCACTGCCAAGGGAGCTCCGCCCAACCCTGGGCCGTCGCCG
GGAAACATTTTGGCGACTAAGCCCTTTGAGGTGGTCTCTATGGACTTCGTTACGTATCTACCCAAGTCTGACCGTGGAAATGTGTTCCTGCTCCTGTTCC
AGTGCGCATTCTCAGGCATCATCATGTGCAAGCCGATGAGTCTAACCACAGCTCAAGATGTCGCTGAGGCCTACATGGAGTGTGTGTCCCAGAGGTTTGG
TGCGAGCTCTCTGCTCCGCCATGACCGTGATCCACGTTTCATGAGCGAGGTGTTCGCCAGGTTCCGCGAGATGCTGGGAAGTCGGCAGCGTGCGACTCTG
GCGTACAGACCCCAGGCAAATGGCCAGCAAGAGCGATCAGTGCAAACAGTGGTCCGAGCCATCCGAGCGTACGTCGCTGAGCCAGATCAGAGCGACTGGG
ACGACCAGGTGGAGAAGTTGATGTGGGCTCTGAACACGACTTTGACGCCACCCGTCTCGACACGCCGTTCTACCTGGTTCACGGCTGGGACCCTCATAGC
ACTGTTTCGGCCATGCTGGGGCCATCTCCGACGGGCTTGGATCAGAGGACTGCTTATGAGTGGCGTCGCAAGACTCAGCGCGAGTACGAGTACGCTCAGG
CCTGGGCTAAGGATTTACAAGCTGAGGCCAAGGTAAAACGCTCGGCTGCTCAGACAAAAATCTGGGCTGAGTTGTCTGAAAGACTCAAGAAAGGTTTCGA
AGTTGGTGATGCCGTGTGGCTATACCTGGCTCGAGTGCAACCTGGGCTCACGAAGAAGTTCGCTCACCTCTGGCACGGTCCGTTCCGGATTCTGGAGACC
TCAGATGACTTCCGATGCAAGCTGAAGATCGAAGGAACTGGGTACAAGTTGTATCCTTGGGTCCACATAAGTCGACTCAAGCCGCGTGCCCTGTTCCCGG
AACGACCTACAGTTGAGGTTGAAGTCGCTGAGGATGATGATCTAGACGCAGCTCTGTTGCCTGAGGATGCTGAAGAACCCGATGAAGCTCAGAATGTGTA
CGAACTGGAGGCCATCCAGGATGTACGCTGGGTTAAGCGGACCCGAACTTCACGGAGAGTCCGAGAGTACTTGGTCAAGTGGAAGGGGTATCCTGACACT
GAGTGGCTTCCCATGTCTCAGCTAAGTTGTGGAGCTTTGCTGTATGAGTTCAACAAGAGCGCCAAGGCGAAAGCACGGTTCCAAGCAATGCAAGCTGGGG
ATGAACCTCCTGAGCCCGATGCTCAATAGAGGCACCTCAGCTGTGAACCTGTGTATATCGCTGTGACGTTCTATGTGTGAACCCTTCGTATTATGTGAAT
TTACGACTATGCTACGTGATGTGGAGACTGACTTGGAGTTTATCGTGGAGAACAGTGGATGAGTGCGACGTGAACGCGCGCCGAGGACCTGAGATAAATG
GGAAGGAGACGAGAAGTACCAAAACGAGTGGTGAATTAGAAATAGCGATGAAAGCTCGTTGCCTACGCTTTCTCAGTCTCCTTGTCTTGCACGGCTTCCA
GAGCGCGAAGCACCTCAGCAAGCGTGTCGTGGTTGTACTCCGGTGCTGGGATAATTGGGTTCGCCTCCCGCTCGGCTCTGCTCTTGGACTTGAGCTCAGG
CGGGACGATCGCTTCAAACTGCTTGTCCGAGCGGCGGGTAGCCCATTGCGTGCGAACTGGTTCTTGACCGTCCAGGGTGAAGAGTTGGTCAGCCAGCGAG
ATCTTGAGATCTGGGTCTCGGAGAATCCAGTGGCACGGATCATTGGGCACAGCCCAGAGTCCGGGCTCGAACCA