Description :
From Genome Similarity Track
Location :
Scaffold_863:10134- 12375
Transcript NameFunction/comments
Phypl_g11344hypothetical protein

Sequence
2241 bases(100 bases per row)
TTTAAATTCTTTGTTTGTCAAGCGTTGATCGATCGGTGTCATGAACTCGTAGCTGCTGAACAGGGGCCCGGCATACATGACGTCGTTCACGATAAAGTAC
CCGACGACCGGATCGCCCACGCCCAGATGAAGCACACCTCCAGGGTCGTTATGCGCAGATGAAGGACAGTCGGTATgcacgtccaccaccaacacgtCGC
GTTTGCACGAGTCCATCAGGCAGTCATAAAACAATTTGGGGTACCATCCCCCGTACTTCGTTCTCCCACTTCCACTCGTTCTCTCCATCACCGATTTCAT
GAACGTCACCTGGTCTTCGTCTAGTTCCTTTCTGATGGCTTGGCATTCGGCGATGTCCCCAagcgtcttcatcgttgAAGCGAAGTGAGCAAAGATCGAT
TCCCGTCGTGGAAGAGTATTAACGCGAAACCTGCGCAACGTCTGCGCATCCTCTTGAATGCTCTCCATCCGCAGCGCCATTTCGCACATTCGCTGCCAGA
AGAGAGGAAACGGGTCCACCAAGCCCTCCGGATACTCAAACTGAACTTTCATTGTAGACTTTTGTGCCGCGTAGAGCACCGTATCATGGCGTAGCTGTGT
GAAGGATGCAATTTGCGTGTTCATTTGGCGACGCTGCCACGTGTCAGAGTGGAATGTGCTTGCCGCGTTGGGAGATGGCTCCGACAGTGCGCGGAGGGCC
CGGAGCCACAACGTGCTGACGCTCGCAGCCGTTGAAGTTACATCAGAGTCCTCATCACTTTCACCATCGttgtcgaactcgtcgtcaATTATCTGGTGCA
GTGCCGCCAAGTTCGACGAGAAGGGAATCCCATCACGGTGAGGTACAAAGTCGTAGGCGTCGCCCGTGGATGTTTGCACGTCcacacgagctgcaagctc
ttgcgctgcttcatTGTTGCCAAACAGAGTAAATGCAATATCCACAGCACTAGGCACGCGTCGCGGCTGCTTCACTCCGTTATGGACAACGTGGTCGCCA
ACTAGTCGAGAAAAAATGAACGCACTCCATACAAaatgctggccaagcaagGCAAACGAGATGGGGGTtacttcttctgctggagcatgACTAGACCAGA
TCTGTGAGCCCATGGAGTATTCGGCaagtcggtgctggagatcaaGCAGGAGTTTCTGTCTTTCGTCATCGCCAGCAATGTCCGTAACTTCGCTAGCATT
ATCGATGGTATTAGTTGAGCGAGTTCGTTCACCGTGACATTGTCAGCTCCGTAACCACCATCAGCAACCAGAGAGGACAGCAACGAATCAAAGTGGACAA
CGTCGTCCAACGTGTCAGATTCCTGAAGACAGCGCACCACGATCACCGAGCACAGTAGCTGATGGAGGTCGTCATCTTGATTGACACCTCCAGCAATTCG
AAGATCAATTCTTCCGAGCCACATCATTGCACGAAAGTAGCACTTCAGAGACGCGGATCTGGTGTAGTGTCCGCGCGGCTTGAACTGTGAGAAGTCAATC
GTACGTCCAGTTGAAAACAACTCGACAGCAACAGTTCGCTCTTCCTGGATTTGCCGACCACAGAGGTTCCAAGTCCTCATAGCCTTCCAAGAGCTGGCCT
CGGAGCAAGCTCAGCCCCATGGCGAGGTAAACTCCTACGTCACTTGCCGCCTCAGCGACCCCATTTTGGGTTTCTGTCGTCCAGGCAATGCATTCGGACA
GACCACCCTTCAGTATCGAGCTTAGCGCTGGAAACATGCATTTCTCCTCCATTTCCACAAGAAACGCGTCGAAACTGCGGTGCCATGCATGCAGAATCGA
ATCTGACGTCACAAACACCGGCAAATCGTCCGAGTACAGGCGGTAGTAGATGTCGCCAACGCTCGAACACTGAAATCGTTGCGATGCAACTACGCCATTG
ACCACGAGCCTGGTCTTCTCTTCAGGCTCAAGACGAAGGTCGAACGTccgcttctgcttgagcgGGTGGTGGAACTTGGACCTCAAAATTTCTTGTACGA
ACTCCACTCCATGCTCCTCTTCAGCCTCTGCGCGCTTTCTTTTAATTGACTCTCGCCCAGCTTCAGCCGGGTCAGCGTCAAACATGTCGAAGAACTTACA
CTTCTCCAGTTCGATCGGAGTACGATCTTCCGTCGAAGAATGGATTGAAGGGTACGTCTCTACGAGGTCCCTCGAAGTCAGCGTAGTTCCCGTTTGCGCT
AACACAGTGGTGAAGGCTTGAACAACATCCCCACCACCCAT