Description :
From Genome Similarity Track
Location :
Scaffold_231:10134- 12196
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_231-snap-gene-0.28Protein phosphatase PP2A regulatory subunit B
Pytap_DAOMBR444maker-pag1_scaffold_231-snap-gene-0.17Conserved gene of unknown function

Sequence
2062 bases(100 bases per row)
TGCGCGTCATTCGATGGTCGGCACCATTTGATCTGGTTGATCTTCTCTTCGATCTCGAGGCTCTTGAGGTAGTCGAACTCGGCCTTGTGGCTCACAAACT
CGGTGTACGGTGTGTACTGCGTCGGCTGCATGCCTGTTCCCTTGAGCGAGTCCAGTAGCCCGGAGCTTCCGCGGCTGTAGATGTTCACGCGTCCGCCCTT
GTTGCCTGTGGCCAGGAACTCGCCGGAGCGGTCGTATTCGATGGCTGAGATCACGTCGGCCTCCACGAGGCTGCGTGTTGGCGCGCCCGACGAGAAGCTC
ACTCTCCAGTCGGAGCCGCGCGGCGCCGAGGCCTCTGGCGGTCCCGAGAAGCCCGTCATCGTCGAGATGTAGCGTCCGCCGGGGCAGTTGGGGAATGCAT
CCGACTCGGCGCCTTAGGCTGCCTGGAGGAGTTTCCATTTCTTCCTAAATGGAAGGCGGTGCAAGAGACCGAGCACACTGGAATCCCCGAACCCTAATTG
aGAAAGTGTGCGATTTCGCGCTCAACGTTTTCGTGTTTGAGAGGGATATTGAATAAATGGTATTATAGTAGACGACTGAGCATAATTCGGACGACGGATG
TAACCGATCCCTAATAAAACACTGCGCTGTGATTGGTGTAAAAAAGGCTGTGTGGTCGTGGCCAATTGGAAGTGGATCGAAaCATCGAAAGGCGcTTGTC
GCCGTTGCACAAGAATCCTCATGACGGGgTCCgAGGAGGCGCGACGCTGCGGCTGCCAGaCCAGCGCAAGCAATCGCcGCGTGCGCATGCCCAAGATCTC
GCTACTTTATCTACACTGGCCACCAGCTCACGCGGCGTTTCTTGCGCTGTGTCGCTTCGGGGgCGTTTTTtCCcTCATGCGATGGTGTTTGTTGTTGGTG
TCGTGTCAACAAGTTCACGAAGAAGTTTCGGGCTGTGCAATGGTGCAGTCTCGATTGAGCATTTCAGAGGATCTTGACCGTTGGACGAAAATCCGTCGAA
GCGAAATCATGTTCTCAATTGCAGTGCATCTCTCGTCAGCCTCACCAACCTCGACGTGCTTGAGCatCTTCAACTTGGGATTGCGGCCCTGGGCTGTAGA
TCCAACGGAACTGACATCGACTCCTGTGGTTGTGGAGATGTCAGTGGAGGCATCACTGAGTGTCTGTGACACAACATCTACGCACAGTGCAACATCGGGG
AGCAACATCGGCGATCTCCCTGTGCGTGGTCACGCGTGGGACGCCATCCTTGGGCCACCACCAGCTTCGGCGATGTACCATGTTCGAGGATGCTCCAGTT
GGATTGTTTCTGGTCGCATGCGGGCTaTGGAAAAGCCATATGAGTGgACTGTTACGTCGTGGACAGAAGGCAGTTCGTATCCGTTATGCATGGCTCAGTC
GGGTTTGGATCACGCCCACGGCCCGGGTCAGACGGGTGGTGGGACAATACCACCCACCCGACCCGTTTGTCCACAAGGGCAACAACCATGGCGCGGAGTG
GCGCGGATGGCGCTGCCGATGGCTCCGCTGACGAGCGTCCTGTGCGCAGGCGAGCCGCGAAGGAGCCCGCACAACTTGATCATGCGTCTACCGATGTCTC
TGCTACGCCCACGCGAAAGCGCGGTCGCGCTCCGGTCAGTCGTCGAGGCAAAACAGGCGGAAACGAGTCGGATGCCAGTAGTGTTGAAGACAAGGGAAGC
AAGCGCACGAGGGGAAAGAAGAAGGAAGAACCGGCCGAGGAGGACAACGACGTGGATGAAGAGGCACTTTTGGCTAGTGTGAGTCGAGAGACGCGCAAGA
TCACGAGGTAGGAAGCCCCGTCTTGGCCTGGATGAGCCCGTCGACGGAGCTGATGATGTGGTTTCATGTGACTTTAGCAAGAGAAAGCGGGAGACCGGTT
CAATCCTCGCGGAGTTCACGAGCTTAGACGCACTGCTGAGCAACGATATGGAGGAGAAGAAGCGGAAGGCGCAGCGTGCGGATAAGCTACGCCGCCTGAA
GGAAGAAGTGAGTGGCGCTCGGAAGCGAGGTGCCGTCGACGCAGGCGCGTCGCCACTCTCCA