Description :
From Genome Similarity Track
Location :
Scaffold_11:1013354- 1015345
Sequence
1991 bases(100 bases per row)
TTCCACATTGGTGTGAGATACACCAATGGATTCATTTGGCAGACTGTTTGCCTGCATGCATTCAAGGCATTCATTGGTTGAAAGTCAGTAACTTCAACCA
ATTAGGATAATAGGATTATGTCAACCATTCGTTGATAAATACCTTTCATGTAGAATATTAGATTAGGAGACTAAACAAACAAATAAACTGTTTTTTATGT
TTACCAGAAATTGGCTTTGCTTTCCTATTTAAATAAATCTATACTTTCAGACGAAAGTTTAGTCAATCTGAGTGAAACGCATCTTACGCTTTTTCTAGCG
TGCAAGCCGAAGTACTGGGCTTAAAGTAGGCCCATTACACCTGGTAGTACTTTGTAGTCCGTCCAACGACCGACTAACTTAAGAGTTCGTATGGAATACG
AGCACGTGGCGAAGAACCAACCAATGGACAGTAATCCGTCCATGTGTAGTCCAAATACTTCTGCCACGCATATTGTGTGTGATGACTGTCCCCATCTGGC
GGATCCAGAGGCAGCCGTAGCGACAATGCTACGTACGCTGTCGCCGAGAGCGCAACACGGTGTTGCTCTGGGATTCATCGTGAGCGAGCAGCGCGATGCT
GCTGCTACGAAAGTGTTGTCCGGGACGACACCGCCCGTGCAGTCGCTGAAATTGCACGTGAGCAATTATGTGGGGAAAGAGGGTGAGCCTCTTCTCCGAT
GGCTTGTCGAATTCGACACTGCCATAGCGGCTCGTCATATCACTGGTGAACCATCGAAGGCTGGGTTCGCCATGTCTTGCCTTGGCGGATGAGCGAGGAG
CTGGGGGTAATGCCACCGGCTCACAGAGCATACGTGCTTTAGCACGTATGCGAAGTTCAAGGAGGGGCTCAGACAAGCGTCTGAGCTATCTCAGAATGCG
GTCCGGTCGAGGGATGAGTTTCTCGACCTGCAGCAAGGTAAGCATGACATTCATGCTTACGCTCCATGTGCGCGGTACCTGATCTCGAACATCGTGACCA
ACTCGATCGACGAGGCGACAAAAGTTGTTACGTTCATGAAGAGCTTAAAAGATGGATCGGCTAAGACCTATCGCTTCCGAGAGCATCCAAGTACTCTGGA
AGTGCGATTGCTCTATCGACGCATGAGGAGTTTTTCTTGAAGCAGGCTAAGCTGCACACGAACGTGCCGAGGATGGCCTGTCCAATGATAAGTGCGGGAG
ATCTAGAGCCTATGAACCTCTCGAACGCTTCCGCTGTTAGACACCAACAGCGTATTGGGGACAAGTGCGGTGTTACCGATGTGGGTACACCGGACACTTT
GCGCGTGAGTGCACAGCGCCTGTGCACTCGGCCAGGGGCCAACGTGGCGATGCCGGGTGTCGCCGTGTGTAATAAGAAAACATGCAGAGCCAATAGGCGC
GTACTTGTATTGCAGTCGCGTGAGTCTATAACGGAGACGCGACACTGAGGTCTGAAGCCCCCGGCGAGAGGACCTCTCGCTGCAAGAAGCAAGATGGCAA
TCCAAATCTTGTTATCCTGAAAGTGACGTCGAAGAGAGCAGGCTCTCTTCGTGCTTTGGTTGACTCAGGTGCGTCAAACAACTTTGCTCGACTGGTAAGT
CTCCCGAAGCTAATCTTCGAATAAGTTAAAGCACCTCGGAGTGTTTGGGAGGTGCGGTAGGCAACAGTTGCCACCGTTAGAACGGATAAATTCGTAGAGC
GCACGCACTTCTCGTACAAGCACCGGGTGTTTGTGGAAGATCTCATTGTCCTGGAACTGGACGATAAATTTGACTTGGTATTGGGCATGCCGTGGCTTGC
ACGATGATCCAGTGCTCAACTGGGAGAACTGTGTACTTGCACACCTCGGACGCAACGCGACATAGGGCGATGGCCCTGTCAGTGTCGCGCATGCACCATG
AAGTGCATCCGATCCCACCGTTGAGGCAGCACCTTATGATGCGGCCTCCGGTGCCCATTCACAAGTCGCAACAACTGAGGCAATCGTTGGG