Description :
From Genome Similarity Track
Location :
Scaffold_35:1013- 5967
Sequence
4954 bases(100 bases per row)
TCACCGGAAGAAGTCCCGTACTGGTGATAAGGCTTAAGGCAACCGACGTAGAACGTAGGATGCGTGCGCATCTTATGTGGCAGTTCAATCGTGTATGCGT
TGCCTAAGCGGCGCGGCACACGAAATGGACCGATGAACTTGGGTAGTCACTATGTGTCGAGGTAAGTTTACCGTAGATAGTAGGACTAGGTCACCTTCAT
TGAATGAAAGAACATTTGCCCTTCCATTCTTGCCTGTGTATTTCTTTTATCGGTCCACTGCTTCAGCAATGGAATCTTGCACGAAACGGGCAACCATTTC
GCGAGCCAGTATGAATTCATCTGCTGACTCGCTGTCTTTGGTTGTAGTGCGCTTGGAGCGCACTGTGGCAGGATCAGTGACCTGGGTAGTAATAGTATCC
TCGCTCTTACTTTCCTCTTATTCACCGAAGTCGATGTGATCGACATCGGCGTCATACGTAGTGACCTCGTGGTCAGTACGTGATGAGTGAGAGCCGAGTT
GGCGTTCACTCGAATGACTCCCTCCCCACCTCAAACTAGAGCTACACTCTGAAAAGGTGGGTAGGCGTGGGTGGCGCAAGCCATTCACGAAGAACGGTGT
ATGCGTCGTCGATGCATGCACCGAGTTGTTGATGGCGAATTCCACCATTGGCAAGAATTCGCTCCAATTCGTAAACGAATGGACATAATGCCGTAGGACT
TCCTCAAGAACGCGGTTTGCACGTTCTGTCTGACCATCTGTTTCAGGGTGGTCAGAGGTCGACATCTGAAGGCGCGTTCCGAGTGTATTGAACACGGATC
GCCAGAATTCTGCAGTGAACCGTGGGTCTCTATCAGAGACGAGTTCACGAGGCAACCCATGAAGACGAAAGATCGTGTCAATAAAAACACGAGCACATGC
CGATGCATTGATAGATTCAGGTACAGCTACCAGGTGTACCATTTTACTGAATCTATCAACGAACACAAGAATACCTGTATTCTTGTGTGGGTCTGCGGGG
AATTCAAAGACAAAGTCCATTGAGACTGATTCCCAGCATTCTGCCGGAATGGTCAAGGGTTGCAACGGCGCACGAGTGAAGGACCTGCCTTCACTCGTTG
ACATACTTCGCATGCACGGACGTACTTTCGCAAGAACTGATACTGGCGGGGACAGTAAAAGTCGTGACTAACTGTGAGATATGTCTTCTCTCGACGATGT
CCACCAGTAGGTGCATCGTGATACTCATACATGATGCGCAGTCGCAGGTCCCCATGGTCCAGTACGACGACACGAGGCGTGTCGCCGGCAACGGCTGTAT
ACTTCAGTAAGCCATTGTGGACTGTATATCTATCCGTGGAGGATCGATGTACTGGGGAAACCTTTTAAGGGATCGACGGATGGTTGCGAGAGATGACCCA
TCAAACACACCATCGCCGGATCGTACGCCTTGCGTATGTCTTCGAATGAGGTTGACGACGGGACAATCGACGTCAACACCGCGACAGTGGTCGGACCAGT
GTCGGGTTGCGCAGCCGGTTCGAAATCGGGCCGGCGCGAAAGAGCATCAGCGACGACATTCAGTCGTCCTGGTTTATTCTACGGAGAAGTTATACTCCGC
AAAGAACGACAGCCACCTCGCCATTCGTTGCGAGAGGTGTGGACTGTTAACGGCTGTGCGTAAGGACGCATGGTCCGTGTATACGATGAAGGGTCTATCA
CCTAGTAGGTAGACCCTGAATTTTGCCAAAGCATACTTCATGGCAAGGAGTTCCTTTTCATGGACTGGGTAGTTACGTTCAGCCGGTTTCAGCTGACGTG
ACTGATAGCAGACGACACGCTCAGCACCGTCTGTGTCATACTGCGATAGTGCACATCCGATGGCAAAATCACTTGCATCGCAGACCACATGAAATGGTCT
GTCTTGGTCTGCAATCGCCAAAACTGGCGAGCGTATCAAGCTTTGCTTGATACCTTGAAAGAGCGCTGGTAATCAGCACTCCATGCCCACTTCTCGTTCT
TTTTCAATGAACGAGAGAGATGAACAGTCATCTCGGCGTAATTGTGCGAGTATTTGTGCAAATACGCCGCCAGGCCAAGGAACTTTCGAAGTCCTTTTAC
ATCGGTAGGCACCGGCCAGTCAGTGATCGCCTTGATCTTTTCCAGATCGGGCCGAACGCCGTGCTTACCCACGATACATCTAAGAAGTGGTATTTCGCTT
GCAGCAAATATACACTTCTTGAGGTTGGCATACAACTTATGCTCACGCATCAGCGTAAGAACCTTTCGGACGTGGAGTTGGTGGACTTCCACATCCGTCT
GTCCATCATAGCCCGGCTATGGACGAACACTTCATCGAAATAGCTAGGTGCGAATTCTTGCACTGATCTCAACAGATTTGTTACACATCTGTTGAACGTA
GCAGGGGCATTACTCAGCCCTTATGGCATTACTAACCACTCCCAAAGCATACCGCTTGGGGTGCTCACTGCTGTATAAGGAATGTCCTTTTCGCGCATAA
GGATCTGATAGAACCCGTCCATCAGATCCGTCGATGAAAAGATGGTACTCCTTGACATACCATCTATAATGACATCCTTCCTCGGTATCGGCGCTTGAGC
CGGTACAGTGGCAGCATTCAACTTGTTGAAGGCATGTACTATCCGCCATCCTCCTGTGGCCTTTCGGACACAGAAGGTCGGAGAGCTATGTGGGGAAGTA
GATTCCCTCACATGATCCGCTGCCAAGCGATCGGCAAAGAATTTGTCAATCGCTAGTACTTGTTCACGAGGCAATGGCCATTACTTCATTCCACAGTACT
TTGAACGTGGTTTCAGGTCTATCCCGTGACGAGTACCCTTATCCTTGGGTAACTCGCACAGCACTGTTTCTGGGAACACATCATTCAATTCCATCAAATC
ATCGTAGAGGATTTGTCTTGAGCGATTCCCACAATTGGGATGTGTATCGCTCAATCCGAGTCTTCTCATCAAGTACACTCTCGTCCATTGATGAGCTGCT
GAGAACCCTTTCGTTCTCAGCGAATACCATTGCCGACCAAATATCGGTTAACTACTCGTCTTCCGCGACGAGTACGCAAATCTGCTTGACTTTGCCACTA
CGCAGATCAAGCAAGAACCTTTTCTGTTCGAGCGTGGGCAATAGAATGATCTCCGAAGTTGTCTTCGGAGGCGCGATCAGATCAAGTTGGTAAGTTCCTA
CACTTGATCCGTCATTGACTAGGACATTTAATGTCTCTGTTGTCTCCTGGAAACTTATTTCCACAGTTGGGCGGGGGCTTATTCCCTCACTAGCCTCTAT
GGCTATCTTGTCATCTGGCACGAGTGGAATTGCTCCCTCGTTATCCTCTGGCGGTGGTTTCGCTTCCCCGACCAGGTCTTCTACGTGCGATTCTCCAATC
GCACTAAGATCATCGTATTGCCAATCATTGGCAATCGGTTCATTTCCACTTGGGTGTTGACCGTTTGGAGGACACCCATGCCCCAGTCCATTCGACTTAT
TCGGGTGGTGGGCCTTCGGCGCGACCTGCGTCTCAATGCAGTCGCCGGAATCTGGCTTCATGGTGTGGCGATCAGCCACTCCATGGCCATGTGCAGTCGT
ACTATCGACCGAACCACACGCGAGGCCATCGCACTCGCCCGTAGTACACCCACATGTTAGTGGGCGCTCCATGGCGTTCATCAGATGGCCATCTGATGAA
CAAGTGACAGGCATATCGACTGTTCGTCGATGCCAGCTGACTTGTGGCTCGTACCTTCTGAGCCACGGCAGTCCAAGGATGACATCAAATTTGTCATCCA
AGTCTAATATGATGAAGTCATCATTGTATTGGACTCCCTTCAGTGTATATGTAATACTCACTACACGTTTCATCACTGTTACGGATGCGCCTGTCGCGAG
GCGCACCGTCATCCTCGTTGGAGGTATTTATAGCTCAACATATTCGAGATCTCTTTTGTCTAGCGATTGGCGTTGTACAAAGTTATTCGACGCCCCACAA
TCGACTAGAGCTCAAAGCGACATGCCTTGTGTCACTTCGAGTTTCAAGGTTATGAGGGAAACCTCATTACCAGAAGCAGCAACACACAATGACTGAGTGT
TGGGAGCAACTTTCGTCAAGAGGCCTGCAAAATCACTTGACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCGTTTTTGGCTGTCCGT
TACGTTGTTGCGTTTTCACAACAATGTCAGACCCACGCCTTGGACCTCGCTTGGCCGCTTGGCGGTTACTGTTTCCTGTGGTACGTGATACCGCGCTCGG
GGCACTGCATTCATATGCGTAATGCCCTGTCTTCTGAAATCTATTGCATTTCTGCAATTTCTTATAGTTGTTAACACGAGAGCTCTTGCTCCTCGTGTTA
CAGAGGTCCATTGGTTCTGGGCCTCCATTTTCCTGTCTTCTCGATGGAAGATAGGAATTCGAACTCGCGTGAGCCTGTTTCACGCTGAATTTCTCCTGTT
TCGCAACCCTTATTGCCTCTTCTAGGGTGTTGAACTCCAATCGAAACAGGTAGGTTTTAACAGGAGCATCAGTTAGACCCTGTATGAGCAACGTAATCAA
CGTTTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGATAATGTGACATATGTACTAAATGTACGAGTGTACGTCACGTTTACCTTGCTTGATTCTAAGG
AGTTCAGAGCAAGCCCTGAACTTCGCTCGAGGCGGCTCAAAATTTTGCCTTAGCAGGGACTTGAAGACTTCCGACGACCCAAAGACATACGGGTCGTGTA
ACTTAAGGCCCAAGGCCCACGTCTTTGCAAGCCCTGCCAAGTTCGATTGAGCAAATGCGATCTGCATTTCCTCATCGACGATATAACGAGCCCTTATGGC
ATCGTCTAGTTCCACGAGCCATCTCAATAGAGAGTCTTCATCGGCTCCCTTGTA