Description :
From Genome Similarity Track
Location :
Scaffold_902:1013- 4110
Sequence
3097 bases(100 bases per row)
CGTGGTCCCAGAAGTCCCGATCTCGACTACCGAAGAAGTCAAGATCGAAGATCGGCAGGTCGGCTATCCTGGATCGGCCACCCCACAGGCGATCGAAAAC
TCCGGCAGAtcatctggaagaagcgacATCTCTTGATCAGGAAACAATGATTCTAACTCAGTTGCTACCTTCGAGATGGCCGCTATTGTTGGTGCGCACC
GAagtcctgctgcagcattctACAGGCAACCCATTCTCAATTTGAAAAGTTCTTgacgacaaggacaaacCGTGGGATGCTAACAGGAAGTTCCGTGAGG
CCAACCACGTTGGAAGAGACATTAGTGAGACTATGGCTGGGATGGAAATGATTCAGTACCGCGCAGCCCTACACACCCTCAGGATGGTAGCCGGCGTTTT
AAACATGGAGAATGCGAGGTGGTAGCACAGCAGATAACCTCGGCTGAAATGCCATCAACGGCGACACACACGGAGGTCGCTAATGATGAATGCGAGACCC
TGTTGTAGGCTGATACGTCTACGGCCGCCATACATTTAAGAAATACATGTTTAAAAAGCTTACATCAGGCCTCAGCACGAGCTGTGCAGCTTGGCAGAGA
GGCAAGTTGCTCAGCAATGAATATATAGCTGTTCATTACCACTTCAGCTGTCTTACAGGCGCTCGTAGCAACCCACGCGCACCTCCTTACCTCCGCCAGC
ATCTTTGGAGGACAGTGACCCTGCAGAGCGTTGGATGCACTATTCGAGCGGCTCTAGAGCTTcaaaagaagaacaagagcgATTAGTCCACCTCCAGAGC
TCGTAGAGCACCACCAGAGCACCACCAGAGCCAATAtacaacttcaactggcCGCCAGCACCTACAGCTTCATCCTGGTGCACCGTGAGGGCCGGGCAGA
TTGGTCTGGGGCTCTGTTATAAAACGCCAGCCCCATAGATCATGTCTCGGTCCACCCCGGTGGCCCGGATGGGTGCTTTCGTCATCCTTCAGCGTCCTAC
GaaggcaacttcaatttGTTCGACCCCAACTTTTACTTTAAGTATTTAAAGCGGCTACCTACGGCTACGGAAACAACTTCAAGCCTAATTCCAAACCCAG
AGTAGGTAGATTCGTCTGCTACCTGTACGACTACAACCAGAGCGCCTACGACTTTGAATCCGACACTGGCGGATATCCGTTGCTGTTCTCGATCCCAGCA
TCCACCAACTACTTTTGAGCCATCGTTTACACAGGTGTCTAGACCCAAACGACAGCGCCAACgcaaggagctccagcgtgaGCCCCAGGCGTGGGGTGTA
GCTTACATCAACGGCAGAAGGGCTAGTTCTAGTGGTGCCCTACTCTATAGGGTCCTCTGGAGGACCCACAAGCATTGCCGGCTGCCGCGCAATTGGGAGC
CACGGCCATGCTTGTTGAGGACGATTTATGGATGCTGTCAAGGTAGTGGACGAATGGGTTGACGGATGTCGCGAAcaagatttttttttcagttcGTCAG
CGAGTTGTACCCATTGTTGCTGGTGCAAAACCGATGGGTACATGCATGTTCCTAGCACTACAGCATGCACTTCTACTGGTTGGAGAACCTCTCGGTGTTC
GAAACACCTACATCCAGGACTTTCTTTCTCAATCCACTGAGTTGCATAAGGACATTTCTCGTGGAATATCATGGAGAATATTTCGAGCTTTTATTTTAGA
GTAACATATAGGTGGATATCGTCTCTCATTGGAGGGCATTGAATTTAACAGGCACCGTACTCGACACCGTGGTGCCGCAGCCATAGTACTTTTGCCTCTT
GATGATGGTGTCTACTTGGTTGCTGCCAGTAATTCTATGGCAGTTGAACATGCATTTGTCCTCCAGGTCCGTGGAGACCAGAGGATAGTTTTCGACGACT
CGTCTCAGCGCCGATTGGACGTCTACGGTGAGTGGATCGACAGAGTGATGTTCGTTCGTAGGGTTGCACTTGTAGATTAAGTTCTAAATATAGTTTTCAA
TTTTAAACTTCACTTTTGTTTTTATTGTAAACTTTAATTTCAATTTGGCGGCTCTGTGCCAGGGAAAACTCTTGGAGTATAAAACCTTACCGAAAGCAAA
TGAGAAAACCTTTTAATGTAAAATTTGAAAGTTCTAAAGGGAAAAAACCGTGCTACCAGGTGACTCTTTAAGTTGTGAAGTAATACATAAATGCTGAAAC
TTATCGTGTAATTCAAAGTCTGTTTAACTGTTTAGCTTAGCGAGAGAGTGCATACCTAACTTATTTCTCACGTTTCTAAACTGGTGCTTATCAAGAGCAT
TAGTGAAAATATCTGCTATCATTGTTTTGGTGTTGCAGTATACACTACTAAATTCATGTCGCTCAACATTCTCTTGTACAATATAATATCGAATATTAAT
TGGCTTTGATCTGCCGTGTAAATCAGGATTGTTCGAGATCTTCTTAATGCAGCTTTGATTATCTTCTTGAATCTTGACTGCTTTCGTGGTTAGAAATCCA
AGTTCTTTTAGCAGTAGCTTAAGGAATATCAATTCCTTCATGCAGTGGCACAGTGCAATGTATTCAGCGTCGAGAGCACAACTGTGTGGTGCTTTCTCGA
AAGCCAGGAAATTGAGCTTTGGTCTATCATAGTGATGTAGCCACCAACAGAGCATCTAGTGTCAGGGCAGTTGGCATTGTCTGAGTCGGTGTACGCCGTG
AGGTGGTCTGCAAGAGTTGTTGCAATAACCAATTTTGATCCTCCCAGTAAGAGACCAAGGTCGTATGTACCTGAGAGGTACTTCAGCCCTCTAATCACTG
TTTTCCCATGCACCTTACCTGGGCTGGCAAGGCATGGGCTTACATCGCGCATCTAGAACGCTAGATCAGGTCTTGTGACCATAAGATACATGACCCTGCC
GACAACTTCAATCCAGGGAATGTCTTGgatttttttgctgtttcaAGTTTTGTCTTTGGTTGCATTTGGGTTGTTAGCTTAGCATTACGATCTGATGGTG
TCGCAACCGAATATGTTACCATTTTCTTAAAGCGATCTAACGCAGTGCGTGCATACTTATGTTGGTGGATAAATATCGTTCGGCCTTCGCGGTTTCG