Description :
From Genome Similarity Track
Location :
Scaffold_1225:1013- 2294
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1225-snap-gene-0.1Aminoglycoside phosphotransferase

Sequence
1281 bases(100 bases per row)
AATCTCCGTTGGTGCCTCAGAAGCAGGCGATCATTCAATCGACTTGGCCGTCGTTCACAGCAATAAGCAACAGAGAGTAGTGGAGGCGGATCAACTCTCC
TCGATTAATTTTCCAATGCGACCACGGACCCAGAGAAGCGAAGCGACGGACAGCTTAAGGTGCTCTGTCGAGAGTAAACGGAGATGAAAGCTCAGCCAAA
CTAAGTTCTCCCAAGTCCCAGCGTTCTTCTGATATACTGGCACAAAACCTGTGCTCGCTATTGAAGCGTGAACATCACGACAGAACATACGTGAAGAGAA
TCGAAACAAACGACAAATTTGGCCATGAGTTGTATAACTAATGATGTAGGACTGACCTTGCCGGCACCACCAACACGAATATATATCGAGGGTTGAGCCA
TTTGCAAGCTGCAGCTAGCTACCTTCGTTACTTTGTTTGCAACTTTTGGTTGGCGCTCACAAGCGAGTCCAATGCGTCTACATCGATATTGTCAAGGACC
GAGAAACATGCACGAACGTTCACTTTCTGAAAATGCTCGTCCAGTTCGCTCCGTAGTTTTTCTGTCTTGGCGTTTGCGGCGAGGTGCTTGCTCAGATGGT
CGTACACGACGAGGATCAAGAACTGATTCAATACGCAAATTTTGTAGTGGTGTCTCCACTCGTCAAGCGTGAGCGTCGCCGCTCCCAGACTCTCCGTAGC
TACCACATCGTGATACAACCGCAAACTGGCGCTCTCTTGCTCACGCCGATCTTGCTCTGTCACACTGACAATAAAGAAAAACGCAAGATCTCGCATCGGG
TTTCCTTTGCCGCATGTAGCCCAATCAAGAAGCCATATTGTTGAATTTGATGGAGCGATGGGGAACAGGATGTTTGCAACGTGGTAATCACCGTGAATCA
GTGTCGAAGGGCCGCCTTCCACTGCATCATGCACACTTTCGAGGAGCTCTGGATTGGCGCTCAGACGTTGGCATAGTGCCGTCAGTCGTTCCTTCTCGGC
AATGCCAAGCGAAATGTCATCCAGATATGCAGACCACAGATCTGGAAACTGCGCTCTCTTTGCTTCGCCAGTGAGGCCACTGCCAATGCCCGCTGGCACG
GCTAACCCCTCGCCATCATGATCCCAAAAGCGACCGTGCAGTTGCGCTAGTTTCTTGACCAGCACTGAAATTCGGTTCGACGGGCATCCCTGAATGCACG
TGAAGGTTTGAACAGCATCCACTCGCTCCAGCACAATTAACACGTTCGATGTGAAGACCGGAGCCGGGACAGCAAACGGGA