Description :
From Genome Similarity Track
Location :
Scaffold_282:10129- 11562
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_282-snap-gene-0.5Dynein heavy chain

Sequence
1433 bases(100 bases per row)
GAGCGACATTGCGCAAAGCGTCTTCAGGCCATGGAAAGAACCAATCGATGACCGTAGCAGAGACGAGTCCCGGGAAATTACGGCACCGAGTGCGCAAAGT
CGAGCCTGAGGGGGACATGGCGAGGATCACGTGCAAATTCTGACGGCACCGGTTGATGTAAAACTTCCAGCAGTTCTCGCTCGTCTCAACGAGTCCGGCG
GCCTTGACCTCATCGCGTACCATGGACGACAACCCGTCCTTTTCATCTTGCTCAAAAAGCGCGGGGACCATTCCGGTCGTGAGCATGTTGTTGATGAACT
CGAGAAAGCCTTCCTCGACCGCGTGGGCGTCTGTAAAGAGGAACACAACCTTGTTCTTGCCCAGCTTGCGGTACAGATCCTTGAGATTCTCGCGGAACTC
GTTCTCGCCGTAGCCGCGCGTGAGGAAGATCTCAAAGAGGTCAAAGCCAGCTGTAAAGGCTGCGAGCCTCGACAGACTCTGTTTGCCACTGCCGCCGACA
CCAATCAAGAGAGCGTGGCCCAATGGATTTCTGATGATTCGAAGGATGCGAGACAAGTGCTCGAGCGCCATCTCAAAGAGTACGAGCGCCATGGGCTTGT
TATCCAGGTTGTATGTTTCCAAAGCCTCGTCAAAGATGCCGCGGATGCGCTTGTACGAGTCCATGTCCTGGTACAACCTCGCGTCTTCCGTGGCCTGGCC
CGTGATGCGGCCGATGCACTCGGCATAGTCGCCAAAGATGATCGGGTCCACCAACGCCACGTCAGCCTCGCCGGCAAAGCTCTCCTTGATAATAGCGCTG
ATAGCCCCATCACATACCATGTTATCCGCCTCGCTCGTGAGTCGATCACAGAAAATTCGCTTGATCTCGTTGCGCCACAATCGTACAACACCCGTGGCCT
TGTCGAATTTGTCGGGCGTGGCCATACAGATGCCCTCACACACCCTCCCCAGGTCGCGCAGGTTGAAAATGTAGTGAAACTTAGACGGCGTTGGCGGGAG
CTTCTCGACTACAAATTCAAAGAATCGCAGCAAAGCTTCAGTCATCTTGAGCCCCTTGTCCTTGACGTCCACGTTGAAATCTCTCAGGTACGTCGTGACG
ATCGAGCCGTAGATCTGTTTCAGAACCTCCTTTGTCGGTGGCGTCAGATTGTAGACGTTGAACTGGGCAACAAAGCGCGGGTCGACCTGGTTCCTTCCAC
CTCCGGGTGGACCCATGGCCCCAATGAACAGTAAATCCTTGAGAATTCTCAGGTCGAGCTCCTTGCCGCGGTCATAGATACTCCCACGACTCATGACAAA
GTGCAAAAGGGCGATAGGCTGCTGGGTGCCGTACAAGTCGACCTTGGGCATGTTGAGGTCGTCGATGAAGATGATGAGTTTCTTGCCGGCGGGCGGGCCG
TAGATCTTGCCCGAGCGCTTGTCTACGTTGGCC