Description :
From Genome Similarity Track
Location :
Scaffold_361:10128- 17054
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_361-snap-gene-0.10Voltage-gated Ion Channel (VIC) Superfamily

Sequence
6926 bases(100 bases per row)
GTTCCGCAACCGGAAGCGCTCGGGATCCGCGGAGTTTCTCTTCACCGAGATCCGCAATGCGTTCGACCCGAACTCACGCTTCATCGCGACGTGGCAGCAG
CTCATCCTCGCGTGCATCCTCTACGAGCTGCTGCTCGTCCAGTACAAGGCGACATTCAGCACCGACAGCACGCCTTCGACCGCGCGGCTCGAGCTCGCAG
GGATGTACTTTTGCGAGCTGGTATTTTGTGCTGATATCTATGTGCAGCTCAACACAGGCTACTACGAAGACGGCAACATACTGCGGGACACACGCAAGTC
GCGCACTAAGTACCTCAAGTCGTCGGGGTTCGTGCTGGACCTGCTGGCGCTGCCGCCGCTCTCGCTGCTGCCAGTGAACATGTCTCACTCTGTCGTGCTT
CTCGAGTTCCACAAGTTTATCCGCGTGCGACGGCTGCCAGAGCTCATCTCGAATCTGGACAACATCTACGCGCGTTACTTCGTGCCGCTCAAGCTTGCCA
AGGTGCTCGGGATCACGCTGGTGACATCCCACTTTGTCGCGTGCGCGAGGTACTCATTCGGCTACGATACGCATCACAGCAATCACTGGCTTCCGGAAGC
CCCGGAGCACGAGCAGAGCAGCCAAACGAAGTATCTGATGTCGCTCTTCTGGGCGTTTGGGCTGCTGACAGGGCTGTTTGAGGGCGAGCTGCCGCACACA
AACCCGCAATTCGCGTTCACGATATTCGTGGGACTCTGTGGATTCTCGCTGTTTACCTATCTCTGCGCAACTTTTTTCCTGCTATCCAAGTGCGAAAGTG
GCGACTCGGAGACAGCGGAGGCGCGTGTGAACCAGTTCAAGCACATTCTAGCGTTTCACCGCGTGCCGCAGAAGCTGCAAGCCCAGGCGGTCGAGTACCT
GAAGCGGTACTACACACAGGCGGAGGCGAATGACCGTGAAGCTGCAAGGTTACTGTGCCCGTCCATCTCCAGTGACATCCAGATCGAGCTGCTGAAGGAC
ACGGTCGCGCAGATCCCGGTGTTTGAAGGCTGCGATACGCACTTTATCAAAGCCGCGACGAGTTTGCTGGAGCTGATTTCGTGCCCCGCCCACTTTGTGC
TCTTTCGAGCGGGCGACCACGGTGATGCGATGTACGTGGTGAACTCGGGTGTGCTCTACACGGTGATCAACGGCGTGAAAATCCGCGAGCTTCGGAAAGG
GAGCTTCTTTGGCGAGGTCGCGGTGCTCGCGAAGCTGCCTCGCTCGGCGACGATGATGACCACCACGTACAGCACGCTATATCGACTCTCTCGCTTTCAC
GTGGAGAAGCTTTTGGAGGGATACCCACGGTACGCGCGCCTCATCTCTCAAACTGTCGACAAGATGCTCAAGAAAGCGAACACAACTGAAGAAGACAAGG
TCAGCGAAGCTGCAAGTGCAGGAGTGGCTCTAGCACCAAAAAAGAAGAGATCCATGTTTCTGCAGGTGGTTTCACTGAAAACAGAGCAGACAATCTGGCG
GAGCAAGAAATCGCTCTCGTCCGTTCAACCTGACGATGGGGGGTCCTCAAACAGTGTCCAGTCGGTTGCGTCATCGATTAAAAGAGGATCGTCAGACAGC
CAAGTGATTCCGACTGGCACAGACATGATCAAGGAACCAACAAGCGATCCGAGTGCTGCTGTAGCGCCATGTAAGAATGGATTGCAAGAATCGAATGCGG
ATAGTTCTCTCGGACCGTCAGCGACAAATGCTCTAGGATTTCGTCCCCAATCGCTCAAAGTGCATCCTGAATCGGGCAAACTCCAGCTTCAGCACCCAAC
TGCCAAAGTCGCTGGATACCACGCGCCATTTTTCGAACCCAAATCGTTGTTTAGCGAAAGCAAGAGAAAGCTGGAGCTCTTTCGCGATAGCTTCTTCCGC
AAAGGCAAGGTCGGTCCGAGCGACAGTAAACCCCAAGATGTGATCCGGGGCTTCTATGACCAGCTGCCTCAAACAGCTCCTCCTCCACCACCGAGCAAGC
ACTGGTGGGCCAAGCTCCTACTCAAGAAGTGCATTGACGCTGAATCCCGAGTTCGCATGGCGTGGCTCTTCTCGCTGCAGCTGGTTCTGTGCTACAATTG
GATTGTGATCCCCCTCCAACTTGCGTTCCCGCTTCTCGACGACCACATTGTTGCGATCGTAGTCCTGAACTTGGTCGCGGACGCGATTCAATGGACTGAC
TTCTACTTGAATTTCAACCTCTCGTACTCGCTCAACTCGGAGAAGATCTTTGAACCGGTGCGAAGCGCCAAGCGATACATCAAGACCTGGGAGTTTGTTC
TAGACGTGCTGTGTGTGTGGCCCTATGGGATATTCCAGCCCTCGCATTTCAACACTGCAGCAATCCGTCTCCCGCGGCTGCTGCGCGTGTGGCGACTGAA
GGGCCACTTCACGGAAGTGGAGAACTACACGCTCATGAACAGCCGACGGCGGCTTCTGTTCTTTGGGCTGATCCTGGTTATGCTCTACCACGTCGTCGCA
TGCTTGCACTTCAGCATCACGCACTGGGAAGGTTTCAGTCACCACGAAGAAGCCTGGATCCCGTCGGACGACATCTACATGCGGCAGCTCAATTCGAGCT
TCTTCATGGACATCCACGGAGACATCTACGAGGCAAACAGTCCGGAGGTCGTCGAAATTGGGGCGATGCAGTACTTTCGATCGCTCTACTATGCAGCTAA
TGTTCTCGCCGCGCTGGGGAAAACGATCGAGCCTGATAGCGACCGACAGTACGCTGTCGCGCTTGTGTTCATGCTCAGCGGGTTCTTGATCACAGCGATC
GTGGTTGACAACGTTCAGAAGCGATTCACAGCGTCCGCGTTCGAGCAGAAAGAGTTTTTTGCGACGCGCACGCGCATCCAGCTCTTCCTGAAGCGTCAAG
ACGCGCCACTGACGATCCACCAGCGCGTGAACTCGTTTCTGGATTTCTGGTGGTCTGCCCATCGAGGAGCTATTATCCAGGAGCTACTGGAAGAATTGCC
AGCAGCGATCAAGCGAGATATTGTGGAGAGCATCTGTGCACCCGCGCTTGAGTCCCTGGCACTGCTTCGTGTCGAAGACCCCTATCGAACTGGAGCATCG
AACGAAGTTCCAGAGGAAGTGCGCTCTCAGCTGGAGTCGATACTGTTCGACAATCTGCGCTTCATTCTGTACGGTCAGGGAGAGATCATCTATCGACTGG
GCGATTATGCTGGTGGGATCTACTTTGTGCTTGAAGGCCGGGTTTCCGTTACGCCGGACGGCGGGTTCCCACACAACGTTCCGCTCGGTGGGTTCTTCGG
CACTGCTGCACTGCACATCCACGACAGCCGAGGGGAAGCAGAAGGCGGTGGAGAGTCTATGGCAGTTGGATACTCGGAGCACGTGATGGCGGTGAGTGGG
TGCATCGTCGTGTACATGTCGCGAGAGCATTTGCTGGCAATGAAGGAAGTCTTTCCGTCGCTTTCCGTGTCGCTTCGTGTACTGGAGCGGAAGCTTCGCA
GCTCCAAGGTCGCGCGCACGTCTGAAATCGAGTCGGTTCGCCCAGGACCGCTAGCCACTTCACCAACACTACAGAGAGCGATGCTTGGACCTCGAGCCCC
GCAGAGCCTGCTGACCAGGATCTGGAGCAATCAGCTTGGAGTTGGATTTTTTTGCCGCAACCAGACGAGTTTTGACCCGGATTCGAGTTTCGTCGGCTTT
TGGGAGACGTGGATCTTCTTCGCGATGACGACGCAGTGGCTACTGGTCATCTATCACATCTGCTTTGGTGTGTACGTGGCAACGGATTCGGTGTCGTCAG
TGTACGTGCGCTCAGACACAGTCACAATTATCCTGGAAATCACTTTCCTGGTTGACATGTACCTCCACTCGCGACTCGGATACTATGCGTACGGCAACAA
GGTGATGGACATCCAGACGATCAAGGCGTACTATTTTCGCTCGTCGCACTTTCTTGTGGACGTTGTCGCCATCATCCCGCTGTTCATGCTCAACTGGTTC
AAACGAGACATGCAAATGCGAGTGGAACTACTCAATATCAACAAGTTGGTGCGCATTTTCAAAGCCCCGCGCCAAATCAAGGCGCTCGAGAGCAGATACG
TCAAGTTGGCAATGGAGCTGCGGCTCTTCAAGCTCGCGTACTACACGTTCCTGGCGATGCACTTCTTTGGCTGCATTTGGTTTGATTTCGCCGCTGATTC
ATCCGGGATTCAAGCTATGTTGTGGCCGTCAGCACACGGGAATTCTACTTCGACGACGTACTTTGGACAAAATACGTGGCTGCCGGGTACGTTACTCGAA
GAGGGCGACCGCAGTCTGCAGTACTTTGGCTCGATTTTTTGGGCATTTGGGCTCATGTCTGCGTCAAACACTGGCGAGCTGCCAAAGACGGTGATACAGT
GCCTGTTCAGCGTCACGACAATGACGGCCGGGTTTTTCCTCTTTGCCTACGTGGTCGGCAACTTCCTGGACGTCATTGAGCTTGAGGACTCGGAGAATCG
CGAGTTTGTCGCCAAGCTGAGTTCGATGCGCCACTTGCTCGCGCATTTCAAGCTTCCGCAGGATATCCAAGAGAAGTTCAAGACGTATTTCTTCTTCAAG
CGGTTCCACTCGATCACCCAGGAGCACGTGCTCGAGCGCGTGCTTCCACCATCGCTGCTGGTCGACATTCGTATGTTTCAGCTGCACCCGATGATCATCA
AGGTTGCTTTCCTCGCAGACATGGAGGACTCGGTGACACGGATGCTCGTATCACTCTTTACGCAGATCCTGTACGTCAAGGACGAGTACATCTGCCGTTT
CGGCGAAGAGGGGAGTGAGATGTTCTTCATCTTCACGGGTATGCTGGATATCCTGGTTCCTGCGGCGTTACTCACAGGAGCAGCACGAACACCAGCGTCA
GCACCTCCGCCAGTTCTTACTAGCAGAGCCTCACCTCAAAGACGGCTAAGCACTCCTCGGAACAGTGTGGGTGCGCTGCAAAAAGTGAACGAGATCACAG
CGGGGAGCTACTTTGGCGAAGCTGCTCTGTTCACGAACGCGCCTCGGAACGCCTTCGTGAAAGCCAAAACGTCGTGCATCCTCTACAGACTCTCTCGACA
GTCGCTCGAGCTGGTTTTCGACCGATACCCTGAGTGGAAGAGGAAAGTGCTGCGAATCGTCAAGATCCAGCAGGAGCAACAGCGGCTGACCCGTCAAGCA
ACTGAAGTGCAGGAGAGCGACGGTGGTGGTGGTAATGGACGTCGTCGCGGGTTGAAGTGTAACCTCTCGCGAATGGACGTGCTGAACTCCCGAGCCGAGG
GCATCGAAGAGCTCCTGTTGGCTCACACGCGAGGCGATAAGAAGAAGTCGCTCGGATTCTCGATCAAGCAAGCGCTGCTCAAGTACAACCTGTTCCCGCA
CTTATACGACGCGATCAAGCCCGTCCTTGAGCGGATCAAGTACGTGGTGACTCTGCTGGTGAATGGCGCAGAGATCCAAACTCGATTCTACATCCTCTGG
GTGCGGCTCGTGTCGCTCTGCACACTCTTCGTCGCCATGCTTATCCCGTACCGCATCGTGTACGACTCCATGGATCGCTGGAATGGCATCCCTGTGATGC
TGCGTATAGTCGAATGCTTCTGCGAGCTCGTGTTCTGGTGGGACATCTGGTTCCATTTTCGCGTGCGGTCGAACCAGGCGGCCATGGAGCTCTACGAGCA
AGACCATCTGTCAGCATACAAGCGCGAACGGTTTGTGTGGGACCTCGCCGCGGCGTTCCCGCTTGACCATTTCATTGCCGACTTTGTGTTCAAGAAGGAG
AACGGGATTTTGAAGAAATGGTTGCGGCTGAACCGATGCCTCAAGGTGAAGAACTTGGTCTACTATCGCAACGAAATCAAGAGGCGCAGCGTGACTTTCG
AACTCGACAAAGTGAAGACGCTCTGGATGCTGTATTCGCTCTCGATCTTTTGGACATCGTGCGCGTATTTCGCTGTCGCCATGTACGACGGCTTTGGGAC
CCAGTGGCAGGCGTGGCTCCCCGCTGAAGAGCTCGCTGAACCAGATCCGGAGCCAGATTTGTTGCTGCTGCGTTTGTTTCGAGGACTCATGTTTGCTACA
ACCGCATTCGTGAAGAAAGGGAAGACATTCGCCCCAACGAAGACGCTGGACTTTGGGTTCAGCATCCTCATCAGCTTTGTGGGCCAGCTCATCATGGCGC
TGATGATCGGCGAGATGGCAAATGTGTTCATCCTCTTCATCGACAACGAAGTGCGATTCCGGAAGAACCACATCACGGTCGAGCACTACCTGGCGCGCTG
GAAGGTCAGCAATGCACTGAAGCTGCGAGCGAACGCCTTTCTGACCTCCTGGTGGTCATCGTACGCAGGCGTGGACTACCAAATGGTCTTTGCGGACCTG
CCGCAAAGTGTGCGAACCGAAGGCATCCTGTACATTGCCGAGAAGCCGCTGATGCTGTTCATGGAGCGCGTATTTCGACCGTTAGCTCGCGGCGCTGGAA
AAGAGGACAACAGTGGTGCTGTTGCTGAGGGCGTCATGTACTCGATTGCGCAAAATCTGCGCTTTGAAGGGTATCCGCGTGGCGAGAACGTGGTCGTGGA
AGGTAGCGTGTGCAAGGCGATGTATTTCGTCGTGCGCGGGTATCTGTTCTCGAAAAGCGCATCGAACCCATCGCTCTACCACGCCGGTCGTTTTCGCATG
GGTGACTATTTCGGCGAGAACGGGCTGCTAGGACACTCAGTGAGCCTCATGACGGTCACGAGCATCCGCGCGAGCGACCTGTTTGCGCTCGACTCGGAGC
GGCTATTGGAGATCATTAAGTCGCATTCCTACTTCCAGCTTGTCTTTAAGTTGGCGCAGGACGTCGTGCGGCAGAAGAAGAGCGTGAACGAGTACTTGAC
AGATGCACCAGTAGCTGCCGTAGCGA