Description :
From Genome Similarity Track
Location :
Scaffold_969:10128- 11313
Transcript NameFunction/comments
g16547.t1hypothetical protein

Sequence
1185 bases(100 bases per row)
GGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAATAGAAGTCACGCGTGAGAAGCAAATATGTCT
TCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCATACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTT
GTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAA
GGTGTGGAGAAGTACTCCACCAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCAGCAAGGACGACGAGGGTGTAGTCGTCCTGA
CGACGCCAACGCAGTTGGCGTCGGCCTCTTGCGCCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGTTTTGTACTCAAC
CTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAG
ACCACGAATGGTCTACTCCCAAGTAGATACACTCGGAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAG
CTGGCTTCAGCTGACGCGATTGGTAGTAAACCACTCGATCACGACCTTCGTGATCGTGTTGCATCAATGCGCATCCGATCGCGAAATCGGATGCATCACA
CACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCAGCTTGACTGCTTCAAAGGCCTGCTGATAATCAGCAGTC
CATTCCCATGCAGCCTCTTTCTTTAATAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCAAGTCCAAGGA
ACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCC
AAGTACGGGTATCTCGGTCGCCCCGAAGATACAGTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTG