Description :
From Genome Similarity Track
Location :
Scaffold_119:101267- 103006
Sequence
1739 bases(100 bases per row)
CTGGCCGCTAGACCAACTAGACGTGGTGACGGCATTCCTGTACGGCGTGATGAGGGAGATCGTGTTTTGCATGGTTCCCGAAGGTGTCGAGCTCGACGGT
GACTTCGACTGCCTGGAATTGGTGAAGGCCATTTACGGTCTAAAACAAGCTTCGCGCGTGTGGAACGAGACTTTCGACGAGTTCGTATGCTCTATCGGCT
TTCAAGTTTCGGCCTTTGACCCGTGCCTCTACATCAAAGTTGTTGATGGCCACTGTGTACTCATACTGGTCTACGTCGATGATGTCCTGGTCACCGGAAG
CTCACCCGAGCTGATCTCACGCACGAAGGACGACCTCAAGACACGCTTCGAAATGACTGACAGCGGCAAGTGTGTGTTCGTCCTTGGGATCGAATTGGTA
GACGGTCCGGACGGCAGCGTGACGATGAGCCAACGGCGTTATGTGGATGACATCCTGAAGCGCTTTGGTATGGACGAGTGCAAGGCTGTGGTAAGTCCGG
TGGATATAAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTACAAGCTCCGTTTCGCGAAGCTGTTGATGCACTAATGCACCTGATGACCGCGAC
GCGTCCAGATATTGCGTACGCGGTGGGCTATGTGTCGCGCTTCATGGAGAATCCCCAAGAAGAACACTGGGTTGCGGTCAAGTGCATCTTTCGCTACCTG
CAAGGCACCAAGACGCATGGAATCTGCTACAAACCGGGTAACAACATCGACTTTCGCGGATACTCTGACGCAGACTGGGCTGGTGACCTCGCGGACCGCA
AGTCGACTTCCGGCTACACGTTCATGCTGATGGGTGCGCCAGTGAGCTGGGGCAGCAAGAAGCAGTCAAGTGTTTCGCTGTCTACGAGCGAAGCGGAGTA
CATCGCGCTAAGTCTGGCAATTCAAGAAGGCAAGTGGATTCATCGCCTACTGTGCGAGATATTAGCAGCTGCCAATGAGACTGGACCCGACCTCAAGATC
CAAGAAGACAACCAGTCGTGCATCAAGATGACAAAGAATCCTGTGAGCCACGGCCGCGCCAAGCACATCGACATCAAGTATTACCACATCCGCGATGAAG
TCAAGCGTGGTGAAGTCAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCTGACATCATGACGAAGGCGCTCCCAGGGCCTCGTCACATGGACCTAGC
AGCGGCTCTTGGTATCCACGCGTGTTCGCATTGAGGGGGCGTATTGAGGGTTGCTGGTCTTGGTACTGTGTACCAGTTGTACCCATTAACCGGTCAACCT
GAACCGGTCCAATACGATCCCGCTGTGATTATGGTACGTTGTTTATGCCACCAATGCAGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGAAGACGTTCGAC
TCAAAGAGTCACTAATACTAAGTTCCTTATCCAAAGGACACTTACAGCCCAAGACCAGGGCTCAAAGTTAACACCTTAACTTTTATGCTTCAAAACCAGA
AGTGTTTTATTTACTATTATTGCGGCCAAGCCGCCTAGGGGTAAATGTATCTCTTTAACTATCTAGCATAGTTAAACCTAATCAAATGCATAACGTGTGG
CTTTCACTCCAACGTACTGAGAGACCTTGTTAACTCTCCAACTTATGTACTGAGAGTTTGTTAACTCTCCGGGTACTTCGTACCCCTGTGTGTTCCACAC
CATGTAACCCCGTTACACTCTCCCTCACTAAGATGAGAA