Description :
From Genome Similarity Track
Location :
Scaffold_52:101262- 104937
Transcript NameFunction/comments
g18241.t1hypothetical protein

Sequence
3675 bases(100 bases per row)
ACCTGCTTCTTTCAAGTTTGTCAAGCTGTACCGCTTCGCCACAGCTTTTGACAAGGTGCTGCTGACGGTTGGCATTATCACGACGGGGGCCAACGGCGCA
CTGTTCCCTTTGATGGCCATTGTTTTCGGCAACGCGCTGACGGGATTCGCTTCCACGCCAGTGGACATGGACTCGGTGAACAGCGCATCGCTCGACTATT
TGTACATCGCCATCTTCATGTTCTTCACAGATTACGTTTCGTACGTGGCGTTCTACTACAGTGCGGAGAGGCAGATGAAGGCCTTGAGGAGTGAGGCTCT
CAAACACATGCTGTACATGGACATCAGCTGGTATGACAAGCATGACGCACTGCAGTTGTCGAGTCGGTTAACGGGAGACACGGTGAGAATCAAAGATGGC
ATGGGCCATAAGCTCGGCTACGCAATCCGGTACATGATTCAGTTCATTGTGGGCTTCATCATTGGCTTTGCGCGTGGCTGGGATATCACGTTGGTGATGG
CGTGCGTTATGCCTATCATGGCCATCTCGCTCAGCTGGCTGATTAAGACAATGACAATCATGGCGGAGTTTGCACAGAAGGTGTATGCTGAGGCTGGTTC
AGTCGCAGAGGAGACACTGGGATCGATGCGAACGGTGGCGTCTCTGAACAGTGAACACAAAGCGATTCAGAAGTTTGAGAAGAAGGTGTTTGAGGCGGAG
AAGGAGAATATCGCACTGCACAAGATGTCGGCTGTCGTATTCTCGCTGTTCATAGCAAGTATCTACGTTATGTATTCGGCCGGTCTGTGGTATGGGGGAT
GGAAAGCTTCGAATGGAAACACTACACCTGGAGACGTGTTCGCCGCCTTCTTCGGTGTTATGATGGGATCGACTTCGCTTGGCCAGATTTCGCCTAATAT
CACTGCTGTCTCCAAGGCTGCCGGCGCCGCTGAAGAACTCTTCGCTATCCTCGACACTGCCAGTGTCATTGACGCAGAGAAGGAGGGCGAAGGCGTCATC
CCTGACTCCTGCAAAGGCAAAATTGAAGCCGTGAATGTCAACTTCACGTACCCGAGCCGTCCCGAGGCGCAGATCCTGCGTGACTACAACGTCACCATTG
AACCCGGCCAGACGGTGGCGTTCGCGGGTGCTAGTGGCGGCGGCAAGAGCACTCTCATCGCGCTGATCGAGCGCTTCTACGACCCCACCAGCGGCACGAT
CTACCTGGACGGACGTGACGTGAAGACGTTGAACGTCAAGTGGCTGCGCTCGCAGATCGGCATGGTCTCTCAGGAGCCTGTGCTGTTCGCCACCACCATC
TTTGAGAACATTGCTATGGGCGGTGACAACGTGACTCGCGACGAGGCCATCGCCGCCTGCAAGCTGTCGAACGCGCACAACTTCATCATGTCGTTGCCGG
AGAGCTACGATACGTTGGTCGGCGAGAAGGGCGTGTCTCTGTCTGGCGGCCAGAAGCAGCGTGTCGCCATCGCACGTGCCATCGTGCGCAAGCCCAACAT
TTTGGTGCTGGACGAGGCCACCAGTGCTCTCGATAACGAAAGCGAGAAGATCGTGCAGGCGGCGCTGAACGACCTCATGGCCACGACGAACATGACGACG
TTGGTGATCGCCCACCGTCTGAGCACGATCCGTCACGCCGACAAGATTGTGGTTCTGAACGAGGGTCACATTGTGGAGAGCGGGACGCACGACGAGTTGC
TACAGATCGAGCACGGCATTTACCAGAACATGTATCGTATCCAGGAGCTACGCTCTCATGAGGAGCAGCAGGAGGCCGAGAAGCGCGAGGCGGAGAACGA
TCTTTCGGGTACGAAGCTGTCTCGTTCAGTGAGTGCTGTGTCGGCGAAGACGGACATTTCTGTGAGCGAGGTGGAGAAGAACTTCCTGGACAAGAAGCCG
TTTGCGCTCACAGATATATTGAAGCTCAACAGATTGGAAGCGAAATACTTCGCTATCGGGATGATCGGGACGGGCGTGGGAGGGATCGTCATGCCAGCGT
CTGCACTACTGACCACAGGGATGATCACATCCATGACGGAACAGTATGGGCTGTACCAAAGGTCTGGCGAAAGATCCCATCTGGCCACAATGTACAACGA
TGTGAAGCTGTACGGGATCCTCTTCCTCGTTGCTGCTGCGGTGATCGGGATTTTCATGTACATGCAGATCTATTGCTTCAAGTTCATGGAGGAGAAAGTC
ACCACGCACTTACGTACGGCGAATTTTAGGGGCTTGTGCCGTCAGAATGTTGGCTTTTTCGATGAGAAGGAGAACGCTACGGGTGCATTGACTGCCGACC
TTGCCACGAACGCTACGAAGGTGTCCCTGCTGTCTGGAGAATCGCAATCCGGTGCTTTCCAGGCGGTGTTCACCTTAATTGCTGCTCTCGTCATCTCGTT
CGGCTTCGGCAGTTGGCTACTCACGTTGATCATGGTGGCGCTCATTCCGTTCTTGCTTTTTGGAGAAGTGGCGCGAATGAAAGAGATGGAGACCAGCGGA
TTGATCTCGGATGACTTGGCAACCCCTGGTGCTCACGCGTCTGAGGTTCTCAGCAACATTCGCACCGTTGCCGCTCTGGGCATCGAGTACAAATCTGCGA
GCGTGTTCGACGAGCTGCTGCAGGAACCTCTTCGCAAAGGCAAGAAGGAGGCACAGGTCAACGGTCTCTCACTCGGCTTCAGCTCCTTCATCCTAATGGC
GACAAACGCGCTCATTTTCTGGTTCGGCGCCAAGAAAGTGGACGACAACACAATTACCTTCACGGAAATGATGCGAACGATGATGGCAATCATGATGTCC
ATTCAGATTGTCAGCAGTGGGTCTAATTTCTTACGTGACGCGCCGAAGGCGTTCAAGGCTGGGTCGACCATCTTCGCCATCCGCGACCGAATCGCCCCAA
TCGACTCGTTCAGCACCGATGGTCTCCGTTTGGCTAAGATTGAGGGTCGACTCGAATTCAAGGACATCTCGTTCCGGTACCCGACGCGTCCCGAGATGAA
CGTGCTCAAGAACTACAACCTCACCGTGGAAGCAGGCCAAACAGTTGCATTCTGTGGCCCGAGCGGCGGCGGCAAGAGCACTATCATCTCGCTGATCGAG
CGCTTCTACGACCCTGTAGTCGGTGAGGTGCTGCTCGATGGCCACAATATCAAAGACCTGAACCTGAACTGGCTGCGCAGTCAGATCGGACTGGTCGGAC
AGGAGCCCACACTCTTCATCGGCACCATCGCCGACAACATCGCGTACGGTCTGGCAGAGCAGCCTAGTCAGCAGGAGATCGAAGAGGCCGCCAAGATGGC
CAACGCACACGACTTCATCACGCAGTTCCCGGACGGCTACGCGACCCAAGTGGGGATGAAGGGCGAGCAGCTGTCGGGCGGTCAGAAGCAGCGTATCGCC
ATCGCGCGAGCCATCCTCAAGAACCCCAACATCTTGCTGCTGGACGAAGCCACGAGCGCACTGGACTCGGAGAGCGAGAAGATGGTGCAGGAGGCGCTGG
ACAAGGTGGTGGCGTTGAAGCGGCGCACGACGATCGTCATTGCTCACCGGTTGTCTACGATTCGTCACGCTGACAAGATCTGCGTGGTGAGCGGTGGCAA
GATCGCGGAGCAGGGCACGCACCAGGAACTGATCCAGCTCAATGGTATCTACGCGGGTCTGATAGAGTCGGCGTC