Description :
From Genome Similarity Track
Location :
Scaffold_340:10124- 12851
Sequence
2727 bases(100 bases per row)
CTTCTAGATCTTGAAGAGTTGTCGGTCGATGATTTTAGTCACTCGTTAAAGAATGGAGACCTTTTAGAGGTAGTGGTCATTCGATCCGACATCAAAGAGT
TGGACTCTACTTCGCTCCTGGATGAAGCAGTTCTAGAGGACACAAAGCGGTACTCAGTGCGCGTAATGGATCTTCAATATTGAAATAAACTCGCGACCAC
TTTTATCCTTTGGTCAAGGAGTTTCAAGGTGTCGTTTGTCACGACCCAACCTCTGTTTTACCCCCAGATAGAGGTGTCCGTCATGAAATTGACTTGGTTC
CTAATATTGTGTCACACGACAGTGGCCCTATCCAAAGGAACAATGTGACACAATGGGACCAAATATTGTGTCACACGACAGTGCAATGTGATTTCAGTAA
TAACTTCTTCCATGCCAAGCATGAGGCAGGAATGATACGTGAGAGTAAATCTCCTTATTCGACACTGGCATTTTGTGTCAAAGCCGAACGGCAAGTGGCG
TATTGTGCATGCTTATAACAAGCATAATGCGGCTACTATTCCAGACATATACCCATTCCTCAAAAAGGCTTTCTTCAAAACAACATGGTTGGTTGTACTA
TGTAGAGTTCACTCGACTTAGTCGATGTATATTACCAATTGCTCATGCGAGCGAGTGATATTCCGCTTACAGCAGTGAGCACTCCGAGTGGTATGCTATG
GTAATGGCGGGTGATGCCCCAAGGGCTGTCTAATGCTCCGGCTACGTTTGAAAGTCTCGTGACACAACTTTTCCGCCCGCAGCGGGATTACGCACATACG
TACTTTGATGACATTTTTGTCCATAGTCGAGCCGAACAAGGTCGGTCAGATGTTGACAATCACGTCGGGCATTTGCGAGCCGTGCTCGCGTGCATGCGCC
CTAATAAATTGTGCACCAACGCTTCTGAATGCATTTTAAGTACAGAAGAGATTCCTTTTCTAGGATGTCTCATTGGTACGCGCGGCATCAGAGCGGATCC
CGCTAAGGTCAAGAATATAGTGGACGGGTCGATTACTCAGGATAAAAAAGAATCGCGTAAGTGTCTTGGCCTTGCCAATTACTTACACAAATACAGTGAA
AAATTACGCTGATATGGCTCGGCTATTAACTGATCTCCTTAAGAAGGACACATATTGGTGCTGGGACAACACCTATGCTGACGCATTTCGGGCAATAAAG
GAGAGTCTCCTCAATGCTCCCATTTTGGCGTTGCCAAATCCTGAGTACCCTTTTAGTGTTGTCTGCGATGCATTCGATTTTGCAATAGGCAGAGCCTTGT
AACAAAAAAGATGCTGCAGGCCGCGAGCAAGTTATCGCATTTAAATCTCGTCAGCTGAAAGCTACTGAAAAGAACTATCCAGTTTCATGAAAAAGAGTTA
CTTGCTATGAAATATGCACTCGTCAAATTTAGACTTCATATACTTGGCTCCAGCCATTCTTCGTCTATACGGATCATGCGTCATTACGCACAGCGACACA
GTCGCCTCACCTCTCTCAGTGAATGGCTCGGTGGATTTCCTTCGTGTGGGATATAAGTTCAAGGTGAAGTATAAGCCAGGCAAAAACAAAATGTGTTGGC
AGGTGCCCTCTCTCGCCGACCTGATTAGAAGCTTGCTCATGTCACGACTTTGTCGTCTCCTATTGAGGAGTTAATTCGTGTGGCCTATCTACGGGACCAT
CAGTGTGTGGAATTGTTTCATGCCCTTGGGGGTGAAGAATACAAAGACTCGGCCAGTCAGTCATCGGCACGATTGCGGGCCAGCGTAGATTGATATTCAA
TCGATGATGGCCTCTTGTAATATCGTACTGTTGTACCTCACAATGAGGATTTAAACTATCAAATCCTCTTTGAGGCTCACGATAATGCTCTCAGTAGGCA
CTTGGGCCGGGAAGAGACTTATGGCTCTGTGAGTCAGCACTACAGGTGGACCAAACTCTACAAATGGGTGAGAACATACGTGCTTACATGCAAAACATGG
CAGCGGGTCAAACCCTCAGCACATTCGGCTGCGCCACTCGCCAGTTTACCTGTGCCCACGGGGTGTTGGGAGTCCATCATGATGGACTTTGTGTTAGGTC
TTCCCAAAGACTGTGATGGAAATGCGGGAATCGGGATATTTTGTTGACCGTTAAGCAAGATGGCCCAATTAGCGGCTGTTCCAGACTCCTTCGATGGAAA
AGGTACTGCTATGATTTTTATCGATAGTGTGTTTCGTCAACACGGGTTGCCACTGGCAATAATCTCTGATCGAGACCTCGTTTCACTGGCGAATTTTTGA
CTTCTATCTTTAAGGTGCTTGGCGCGCGATTAGACATGTCCACAGCAGATCATCTGCAGACCGATGGTCAAACTGACCAAGTTAATCACATCATCGGAAA
TGTTCTTCGTAGAGTTTGTGCTGAGTCGCCTAAAACTTGGAGCTCGATGCTCCCTGTCATTGAGTTTGCGTTGAACTACGCTGTTCATGCCTCGACCAGA
TTTACTCCCTTCTGTGTGAAAAGCCTAACACACCCGCGCGTTCCGCACAAGTTACCACTACGTGGTTCTGGACTTTGTGGGGGAGAGTCTACTGACAAGC
TTGCTGAAATCAGCCCTACCACGATGCAGAAACAAGTGAGCGAGTTTCTCGCGACGCACTTTAGTGTCTCACGACATGTGCGTGATGCAATGGCTGATAG
CCAAGACAAACAAAAAGAACAAGCTGA