Description :
From Genome Similarity Track
Location :
Scaffold_410:10120- 11897
Sequence
1777 bases(100 bases per row)
CGGAGCACACAGGCGTTACTTGCAGCGAATTAGCGACCCACCGCTTCTCCCGCAGGTCCTTTTTCGCCAATCACAGCTGCCTAAAAAACCGGCTCAACAA
CAGTAGACAGCCCTGAAAGAGCCAGACAAACAGTGGGTGGCTCGAGTGGCGGAGGGTTCAGCGCGACTGCTGCTTGCTGCCTTGCGTGCTTGCTTTGTTT
GCTGCTGTTGCGGTTGTTGACTCCAGGCTTGGCTTGCTTGCTTGCGTCGCGAATGTGCCAGGGGTTTAAATATGCGAAAGGAGAGTTTGCTTCGAGTTTG
CTTGCTGCAAACTGAGCAACTCGTCACCAATCTCGCAGACCAGTTGCTTCACCTGACCGCATAATGCACACCCGTTTTCAAATACTGGTATGCTCAGTTA
CATTCGACCGGTCATAATGCATACCCTTTCAAATATGCTCTTGCGACAAGTATAATTCTGTATATCAAGCAGGATTTTAGCTATCTCCACAACATGATAT
CCCTTTTTACTAGGGTGTAGTATACCCATTCGCTAATTGAGTCGGCAACTGTACTGCTAAATCGTAGCTGTCTGTCGTCCGATTGTCGTTAACTGTGCAG
CTACGATTTAGCTAAATCGCAGCTTTTGGATTCGTACTTTGGCGGAGTATTTTGGAAGCATCGAAGACGGCTCGGAATATCTGGAAGACAGAACATAAAT
CGTACATCCATACAAAATCAAGTCAAAAGGAAGAGCGGCTTTTGATCAATATATCAGAAGCTGACAATTTGATCAAAAGTCGCCCTTCATTTTGACTTGA
CTTTGTAAGGATGTACGGTTTATGTATTAACTCTATTTAGCTTTTTAGCCAGCATTTTCATTTCGAGGTTCCAAGATCTATGCATAAGCAGAATATGCAA
AGCGGCTAAAATGTCGTCCAATCGCAATTTATCGCCACATTGTGAAATCGTCATTTCTGAAGATTTTTTTGACGCGAATTGTTTTCATGCACGTGTTGCT
TGTTGGCATTGACCAGCGCAACAAGTGAACATGCCTCGTGCAGCATGCCTCGCATGGGATTGCTCTATTGTGAGGTGTAACTATCTGTAAACCGGAAAGC
GCTGGCCAACCAAGTGAATCTGGGGGTGGGCAGTCTCATTTTAGCCCTTCTTTTGCCGTCATTTTACATACCGCTCCAGATTAGACTGGACACTTTCCGA
TGTCATTCCATGTCAGTCAGTCAGTCAGCCGAATTCCGACCTCTGCCTTGTCTTCCGAGAGGCAGGTCCATTCCAAGCGATCTACGACGAGCAAAGCGCG
CGACATACAGTACCGCCAGCGTAACGCAACGAGACGCCCTGTTTGCTGCCATTCGAATGGCGTGAGTGACCCCAGTCACCACTGGGCTACGAGTGGTGAT
AATGACAATTTCAGCCTGCGTTATATTATGATTTGCTGGTTATCAGCTGCGTCGCGGGGTCGAGACGGCGACCTGCAGCACTTTCTGGACGTACTCGACG
CTGAACTCACGCACGAGCGCGCTCGGCTGGTTGCCACCGCTGCTGTCGCTCTCGGACGAGAGTTCACGCGTCGTGAGGCGGAAGCTCACGTCGCGGTCCT
CTTGCTGCGCCGCGATGAGGCGCTTCCGCGGCGTGCAGGGTCTGCATTTGCCACCAACAAGGTTAGGTATTGGACTCGTACAGGCAATGGCAGGTACCGC
GCACCTCTCTGGTTCTTCCGACGACATCACCTTGACGCTTGCGTTCGTGCCTGGACCTGGCGGTTTGTGAAATGAGC