Description :
From Genome Similarity Track
Location :
Scaffold_1495:1012- 2609
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1495-snap-gene-0.2RNA and export factor binding protein

Sequence
1597 bases(100 bases per row)
CCACCATGTCATCCATCTTAGCCTCGCTGGACATGAGTCTCGACGACCTGATCGCCAAGAAGAAGAAGACGTCGAACCCAGACTCGCGCGCGGCGTCGCG
AGCAGGCAAGGGCAAGGGTAGCGGCAAACCGGAGGCCGCGAGCAGCGCCGGCCCAGTGCGCGGTCGCCAGCAGCGCAAGCGCGGAGGCGGCGGAGGCGGC
GGTGGTGCCCGCAACCAGCCGTACGGACGATCTGTAAGTGAACTTCTACAACTTTGACACACATCCACATCCACAAACCTGCGCACACATTGAAGCAAAG
GGCAAAGCCGCATCGAGAGGGGGAACACACATACACAGAGAGACGCGCGTGTGCACTGCACTGACTGAGTGCAGATTTGGTTCGCCGCGATGTGTTGTGC
GCCGCCGCTTGTGTGCCTTTGGAAACGAGCTGTGTTGCGAGTGCGAGAGTTTTAACGTGCGATTCTGAATCCGTTGTTGTTAAAGAGAGACGGAGGAGAC
TCGGACGCCATGGACGTCGAGGACGACAGCCCACGCGGTGGCAAGAACGTGGCGGCGAAGAAGCGCGCGGTGGTCGTCAAGCAACAGGGCAGAGGCGGGA
AGAAAGGTGCGTTGGCGATCGACGCAGCGTCAGGGATCTTTCGAGGTGTTACTCTTCTCTCGAAAGCGATGATGCAAGCGTGATAGTACCTCTTCACTGA
TGGATGGCGTGGATATGCTTATACTGACCATTCTTGTCCGATTGCATCTACTTCAGGTGGCTCCATTCTGTCGCGTCTTGGAGGCAGCACCAAGGACGCG
GTGAACAACGGCACGAAGATTCTCGTGAAGAACCTGAAGTTTGACATCCTCGAAGACGATGTCCGCGAGCTCTTTGGCACGGTCGGCGAGGTGAAGAAAG
CAGAGATTGTCTATGACCGCTCGGGCCGATCGAAGGGGATCGCGCGTGTCTGGTTTGCGCGCAAGTCGGATGCCGAGAAGGCGCTTAAGCAGTACGATGG
TAAGCACGTGTAGCCACCCATTCCTGGCTCCTGTTGCGTTAAATGGCGCAGCGTGTGTGTTATGTGAGCGGGAAGTTGACTAACGAGCGATTTGCGATGC
TACCTATGAAGGCCGCACGCTTGATGGCCAGCCAATGCAGCTCTCTTTGGACGAAGACAAGAACGTGCGCAAGGGCTTGTTCGGAACCGCTCTTCGCGAC
GACAAGGACGTGAAGTTCAAGGTGTCGCTTGGGTACGTTTGACGTTTGTTCTAGCGGTTTTTTTCTGCGTGCTTGCGAATGTTTTGCTGACAATGCAACC
CTTGCTATTCTCCTCACTTTAGTGGAAACGGCGGAGCCCGTGATCAGGAACAGAAGGGTCGTGGTCACCAGGAGCAGCGAGAGAGAGGCCGTGGTAGCAG
TGGTCGAGGTCGCGGTGGCCGTGGCGGTCGTGATCAGAGGTAAGACGGTGAATGGCAAGGATACGAAGATACTGGTAGTTTGATTTTCCACTAACGGATC
CTACTTTTTTTGTATGCGCAGCCGTGGTGACAATGCACCCTCCAAAAGCGCCGAAGACCTGGACAACGAAATGGACACTTACATGAAGGACGCATAA