Description :
From Genome Similarity Track
Location :
Scaffold_161:101186- 103059
Transcript NameFunction/comments
g17581.t1hypothetical protein

Sequence
1873 bases(100 bases per row)
GGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCG
GAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCA
AGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACA
GGGCGGGTGGCGCATCGTTCATGCGTATAACAAGCTGAACGATGCGATGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATG
ACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACAGCGGTAAGCACTCCGA
GCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGA
CTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAGGTCGGATGTGGAGATGCATACAGAGCATTTCCGCAAGTTGCTT
GAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATCCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGT
ACGCCCTGACCCAGGGAATGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGC
AGGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTTG
AAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAATATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGG
ATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGAC
AAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTA
CGGCGATAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCGGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAAT
GTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTACAAGAGGCCGACGCCAACTGCGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCT
TGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGC
CAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGAT
GATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATTTTTGCTTCTCACGCGTGACT
TCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCATCGCGTGAAGCC