Description :
From Genome Similarity Track
Location :
Scaffold_1:1011801- 1014061
Sequence
2260 bases(100 bases per row)
AGTCTGGGCGACTGCGTGTGGTACTGTGTTATCCACACAGGAAGCGCATTCAGCGCCTTCCTCTTCAATTAAGGTCTGTGCGACCGTGTGGTCCTAAGTT
ACCCACCTGGTTAGCGCTTAAAGGCATAACCACTGTCGAAGCGCGTACGGCACGACGACCTTCGGCGTTGGACGCTGCTGGTGTAGCAGGTCCACACGCC
GGGCAAAAGACCCACGCCTGTGGCATTGCCGCAGCGGAGCATGGTCTTGCTGTACGCAGAGCTGTCGGCGCGTTGACAGCTCCGTGACGCTTCTGCGTCC
TGACGGTCTGTATCAGACGCCCCAGTCATGACGGAGGTGGGAACATGACTCACCAATGCTCCGTCATAGACCTGGACTGGTAGACCTTTCTCAGCCTTGC
CACACCAAAGTCCGGGCTGTGCCTTATGTTCGGCACCGCCATGTTGTTCATGGCGAGAACGGCGAGCGACAGCGCGGTGCGCGAGTTCATCGAGCCGAAA
CGTTCAGGTCCGTTGATGACCATTGGTACTTCCTTCACCGTACCAAAGGCTAGTCCACCAAGGACCAGCCCACGACCGCCACTCTGACATAGAGTGCAGT
CGGATGTCGCTATACCAAGCGACGTTCCGGCGGCGTATCAACGCCCCAGAACTCATCAAACGTTCAAGGGGTACCGTACCCCCGTACACCGAGTGTAATA
CCAGCAGCCCATCACTGCCCTTCACCGGTTTGAGAGAACCACGTCTCTCTGGGCTAAGGCCCGTGGTGCGCACAGCCTGCACACCCATCACGAAGGCTTA
GCGCTCTTCAGTAGGGCATACTGCCTCTACTGGTGGCCGGGGAGTCTTCGTCCACCTGGCCGTGGCCTGCGCCACCGGACTTGGGGCCCACCGGCCGTCT
TCTTCCCGAGGACTAGCGAGGGACACACACGCTGGTAGTGTCCATGTCCGCCGCATCCATATCAGCGGACCAAGCTCTCGGCCGAGCTTAAGTCCATGGG
TTCGGGCTCGCTGTACGCACCGGTATCAACGGGCTGCGTGACAGCAGAAGCAACAGCGTCATTGCTGCGATGCTCCGCTTCCCGAGGAACGCCGTTCTCA
ACGTGGCGATGTTCCTCTTCCCGAGGAGTACCAGCCTGCTTGTGGCTGTACTCTTCTTGGAGGGCGATTCGAATCGCCTCCTCCATAGCTGTCGCTTGCA
CCCGGAATAGCTGGGTGCGAGCAGGACCGACCTTCAGGCCGTCCATGAAGACTGTTGTCTTGACGTCTTCAGGCAGAGGATTCCCTGCCAGAGATGCCAC
CAACGTGCGCATCTCTTACGCGTACTCCTGCAGCTCACGTTTACCTTGTTTACACGCGAGAAAGCGTGAACGCTGGCGGAAGTCGTTGTATACCGGTAGG
AACGCGGCTCGAAGCTGCTCACACAGCTGAGCCCAGGATGCAAAGCATCCAGGCGATGTCGTCTCCCTGGTGTATGCCCAGTGCTTGGCACGTCCACCAA
GGTTGGACAGGACAAACGCCACCCGAATTGGCTCGTTCGGGATGAGACCCGCCTTCATGGCGATCTCCACCTCACGGACCCAGAAGTGAAGGTTCTCTCC
TGTCTCCCCCTCAAACGCGGGGACCTTCAGCCACACCGGCTTAGGCCTAGTTGCCTGGGGAGCGGCCATCGTGGCCTCCAAGCTCCCGCGGACGTGAGCG
ATGAGACTACGCTCGTAGGTCTCAAACGCGGTCACGCGCTCTTGTTGCTCGGCAGGCGTCGCCGCCGCCAAGCTGCGAAGGATATCTTGTCCAAAGATGC
CTCCCATCTTCCGAACAGACTCGTACTGTGAGTCGTTCAAGCGAGAAAACTCGCTTCGGTCCATCTTGGCTCAAACGCTGAGCGCACAGAGGATTTAGGC
AGTTCAATCTACTCGCGATGGTGTTGGATTGACTACGAGTGCTACCAAGTGTGACATGGTCACACAGCACCTTGCACAGAAAAAGTGCTTAAGGGTATTA
ACTACCCGAGTGAACGTTAGTTCACGTTTTCCCGGCCTCAAAGGGAACGGTTTGCTACTTAGAAGAGTAGATTTAAGACTGATGTATCTATAAGTAAGAT
TAGCTTGGGTATCATACAAACTAGTGGTTACCTATAGTGGAGCTAAGTAGTTATGCACTGACTGGCTCCGAGAGCACCTGGTACCGTGTACCAGGTGTCC
ACAAGAGTGACGGGTTACTCTTTATGTAACATGGGGCACGCTGGATTGTACCCCGTTACA