Description :
From Genome Similarity Track
Location :
scaffold_12:101160- 103510
Sequence
2350 bases(100 bases per row)
TTCCCTGCACACCCAATGAGTGGGTCAACTCGCTCCGTGCAGCAATCTCAACGCATAAAAGATTCAActtgaatttgccaaagaGATGACACGTTTCTTC
TGACCATCGATCCAAAGTCAGCCAGTGATTGTCATATCAATCGGGCGCCAAGAATCTTGACCAACGTTTGACACAACTTCGCTGTCAACGTCAACTATCT
ATTCGACCCAACGGCCGCCGACTAGCTATGTTGGCAAAAATACTTTGCCGAGGAGCACTATGGTTGTAATATGACCGGTCACCTTATCACTGACAGCAGA
AGATaattcatcttgctcagatggtctttaaagacaaaaaaaacaGTGTTACCGGATGCGTCTTTCGAAAGGCTGAAAACAATGTCCGTATTTTTGTATT
GCTCACACTTTTTCTGAATCGATAGGCCTGTTAAGGGTGCCGACGCATGCGGCAAGGGTTGTATTCGATGACACGTTTCACTCTTGCGCACATAAATGCG
TATTGATATAATGGCCACCAGTATATAGTGCTCACGGAGTGAAACGGTCTTTCAGTGGTCATGAAAAAGATGTCATGTACCTCGTGTGGTATTTTATACT
TGAGGTCCACGCCATGAGACGTCAATTGACGCCTAGTGTCAAGTTGATTAATAGCAAGTCTTGGAATACCGAATGGCTGTGCAAACTTGCAGCTGCTTGC
TCCGATAATATGACATCTGACTACCAAAACGCAAATATTACTTATGCTTCACCAACGAAACTCATGGTACGGCTGATTTGTACACTATACACTTTGCCTC
ATCAATTGGCGACGCCATTATCATTACACGAGACATATCATAGTCGGACGACGCGAAAGTGCATCCGCCACTACGCTAAGCCGATACGTCTTATCCCACA
CCTCAAAAGTGTACCCACAAAAGATGACAACTCAATCCTGCTATACTCTATTAATGACGTGGTAATTACGTCGCCGTTCACAAAATAACAAACGAAGTAG
AGGCAAGACCGAACcatctgaacttgacaaggtaATACTTTATTGTAAGaagctccttgtcgtgaacaaTTTTATTCGTATTTTTGCTCTGAATTTGGGC
GACTAAAACGAATTCCGCGATGAAATAGAGAGAAGCGGAAAGATTCATCATTGCAATGATGATGTCATCCGAAAACTTGTCGGGTGCTCTGTAAAGTCAA
AGTAGCGCCGATAAGAATGGTAGGGATCCACAATACTTGTTGTTGTTGGGCTGACGGCAAGCCTCTCGTTGCTAAATTTTCTGTAGACGGTATCTTTGCC
AGCAGTTCACGACCGTCGTCAAATAAGTAAATTGTTTCGATACTTGCATTTCATGCTATATTTACACTGACCAAAGGATCGAAAATCAATGCCTGCACCG
AGTTAGGGAAATAAGCTTCATCACATCGACACTATAATTGGATTAGAGAACAGTCAATATCAAAGGTCGAGGCATCAAAACCACCATAAAATGGCTGATC
TGGATCTGGTGAAGCCAGAATTGGAGCAAGCATGACGCTATTCCACAGCCTTAGGGAGCATCTTTTCTGTTATATACCAGCATCACTGACATTCTTTTTT
GGGATTTTGGTAGGGGCCGCTCAAAATTGCACTATGTTTGAGATGAAGTTGGCTATGTCAACCACATCATCAAGTATATTTTGGACTGAGGCACTGGCCA
ATCTTCAATGACCTTTATCTCGAATTTACCCGCGCACCATGCATCCCAATAAAACAACGTCGACAATATATCTCATCGCCGCCTGGCTTATAACTTATCT
AAGCGTATAAACTCGAGCAAAGCTTGTAGCAGTTTCATGTGGCTCGCCAAAGCTGGTTTGCGTACTTAGCACGATTATAGACGAGTATGCCGCTGAAATA
GGTATGTTTAAGCTCGACACGGCCTGACCAGCTACGTTACGAAGCGATTGTCGCCGCCGGTGCATTGAAGAGTTCAAGTAGCATgacaagccactcccaa
atTATATGTACTAAAATATCTGACCGAAGTGAGAACGATATCGCTGTCTCTCTTTAGCACTTGATACTATTCACCAGCTAGATCAAGTGTACCGAACAAT
ATACAGCCGATCATGCTACTTTTCAGCACATCAATATTCGGCGTTCGCGCTGGAATAAAGGCGGTGTTAAGCTCATCAGGAAACTATACAATTTGCCAAT
TGCCTTTAACCTTTCTGACACAGAAAGTTCGTGTCAAGTAAAGAGATTTACTCTTTTCTGTGAATTCTGCCTCCTGCATTGCAGgaaaaagctttgatga
CACCCCCACTACTTATTTGAATAAGGGCATTGATGTGCGATGAAATACTT