Description :
From Genome Similarity Track
Location :
Scaffold_605:10116- 11119
Transcript NameFunction/comments
g9184.t1hypothetical protein
g9185.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
AAAGTTGGTTCATTAGTTCTGTTAGCTACACAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCAT
TCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACATTTTACGTTGGGCGACTGAAGCCGTACGT
GCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCAAGGCGCCAGAGAGCCTCGTCCCGACCTCGAACGTAA
AGGTCGAGGTCGTCTGCGCAACTTCCGCGAGCTGAGCCTTCAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCTTGGAGACGCTCAACAGC
CTCCAAGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCCCCACCCCCGTTGCGAGACGCACGCGGGGCAACTCGCTGGATCGTCCAGCG
AATTGTTGGTCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGTATTCGTTGGAGAGGATTTCCTCCCCAACACGATACGTGGGAATCACGGAAACCA
CACAACACCCCACACACACAAAATTCATCACGGCGCACACAAAAGCCAACACCGATGACCAACAATTCGCTGGACGATCCAGCGAGTTGCCCCGCGTGCG
TCTCGCAACGGGGGTGGGGGGAAGACGCCCCGGGTTTGGCCAACCAAACCTTGAGTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAACGTCGCAGTTCGCT
GCTCTGCGTCAGGAGCTGAGCTTGTTGAAGGCTCAGCTCGCGGAAGTTGCGCAGACGACCCGTACGAAGGCCGCCACCTCCACCGAAGGGCGTAAAACTT
GGGCGAGCGCTGTAATCGCCTACAGCACTCGGATAAGTGCTGCGAGTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAAACTAGCGCGCAGGGTCTAGA
GAT