Description :
From Genome Similarity Track
Location :
Scaffold_53:101153- 107745
Transcript NameFunction/comments
Phyke_g3492hypothetical protein
Phyke_g3493hypothetical protein PHYSODRAFT_360816
Phyke_g3494hypothetical protein PHYSODRAFT_561066

Sequence
6592 bases(100 bases per row)
CCAGAGACCAGCGACACTGTCCGAGCCAACATGATGATGTGTTGCATCTTCCGCCAGGTGCCTGGGTTTTCTACCGTGGACGTTTACGTCAAGGGAATGT
TTGACATGGGTGGGGATATTCCATCCTTCCTCATGTTCAACGCGTCTTGCTCGTTGATGTTTTCGATTCTTGGGGCGATAGAGAGCGCCGAAGCGAAGCG
TCTAACGCTTTTGTCCCTGCAGAAGGCAGAAAACTCAGTGTCGTCTTCGTTTGCTGACATGTCGGGGTTTGGGACGGATAGTTTTGAGTTGACTTCCGAT
TCCTTGCCCACTGGGTATTCAAACTCCGCCTCGAGTTTGTCAGCAGAGGCGAGCGCCGCTATCGCTGCAATTACTCCAGCACTTGCGCGTATGTTGTCAA
AGAGCAAATTGAAATCCCGCTCGAAGCGACAATCAAATGCTGAGCCTTGCTGTGTGTGTTCTAAAaaacctgcagcttccatcGTCGGCGCCACCCATCG
AACCTGTGGTGTCTGCTTCCGTGGCGTCTGCAACAAGTGCCACATCAAGCGCAAACTTCTTGCACGTCCTCAGCCAGTGCCGATTGCCTGCTGCAAGTCG
TGTCTGCTGGAAGCCAAGCAGCTAACTGTGGATCCTCGTGATCCGTGTCCCATTCTGCCATGAGAATGTGTCAATATTTCTCTCTGTCATTTGTTGCTTA
GTCGTTTGTGTACATCGTACAAAATCTTGTAATGAATTTCCACTGCCACACATTCCGTCCAACTTTGTATGTCATTGTTGCACCTGACAAATCGGCAAAA
ATGTTTTTCGATATCGCAAAGTTCGTCTTCGCTTTTGATAATTCACTTGATTAATCCCCACGCAGATAGTTACTTATTTTGACAAAGCCATATACTTTAA
GGACGTGTAAATATTTAATTTTGTTATACTTGAGTTCAATAAACTCTTCCACTTCCCTGTCCGTCGCCAATCACTTTGACACAAGCATCAACAATGGCGA
GTGAACCTGTGTCTAAACTACCGTTAACCTACTTGTATCTAACCCTCTCTATCCACTCCAACAGGGCCGCAAGAAACAATTCATCAACAAGAAGACGGCG
CAACACTACCACGTAGTGCACCGCAGTCAGAGGGACCCGAAGGCCAACGACCCGGAGGCCTCCAAGTACGTTCTCCTCTCGTCCACTCAACAGGACGTGG
AGCTCCGTTCCGACTCCGAGTATGAAGACTCCGAGCTagacagtgacgacgaaatgCCCGACCTCGTGGACACACCCGCCCCTAAAGCCAAAACTTCACT
TAAATCGACGGGTAAAGGTAAAATCGCCTTCCCCACGCGCAAAGTTCGCTTCGGCAGTGTGGAAGCCGAAGACTTGGTGGACGAAAATGGTCTGCCACGA
GATGGTTATGACTACGCACAACACATGAAGGAGATGGGCCACGGCAAGTTCTACTCAGCCACAAGTCGCTTCGATGCCTCAGAGGAGAGCCGAGCCATGT
CGAGACATGTCGAGTTGCCGGAGGACGCTCTACCCAGTGgggaagagcaggagcgaCTATTAGATGCAATTACTCTAACCACAGATGTGATGGACGAGGA
TTTACGTGAAGCTCTAGTGAACGACAGGGCGTTCGAGGAGTTGGACGACAATTTTGTGTTGCAAGCAGCTGAGGAGAATGAGGCAGAAGGCGCGACGGAC
GATTTCGACTATGACGCTCATATCGCTAAACTCATGGAGGCAGCCAATGGTGTGCCTAAATTCCGTGGCAACCTCACTGatagtgaagatgaagaggaat
ttagtgacgacgacgatgacaatgaagaaTTTAGTGACGGAGAAGTGAAAACGCCACAAGAGAGAGACGAGGCCCAACGTGTTTTAGATGAATTGTTTGA
GAAAACTCTGGCAGAGGAATACGACGATGAACAGTTAGGTGAATTGGAGGAGGACGACCCGGAGACTCGTGGAGAGGAGACACTGGATGGCGCTctactg
gaagctgtgaTTGAGGATTACGCTATAGTGCAACAAGAATTGGCAGATGCTGAAGGGAAGTTAGGGAATCCTCTGCGTACTGGCAAcagactgcagcaag
tgctggaagAGTGTGAGGCAGAACGTCGTGCGtatgaggaggacgaggatgccacgacggaagaagacgaagtggaggaagaccCAGTGGCTCGTGCTAA
gagagaggagaaggagattCAGGAGCTCTATGAGCGTAACAAATACTTGCAGCGTGAAGAGCGAGAGCAATGGGACTGTGAGACGATTGTCAGTACGTAC
TCGACGCTGGACAACCACCCAACAGTGCTGAGGGAGGAAGCGccgaagcgcaagaagaaaaaacaggCTGTGGCTGTTACAGCTGCAGTGACTGAGGGCG
TTCGCACGCAGAAGGTGACGCTGTCGCGCAAGACTGGGATGCCCTTGGGCGTATTTGAGACTGCGGCGTCGACGAAGGGCGAGGAGCCCAAGATCTACAA
GGAAGGGGTGCAAGACAACAGAAGGCAAAAGGGCGAgacgaaggaggagaaacGTGCGCGTAAAGCGGCTGTCAAGATGGACAAGATGACGAGACGtgct
gagaagaaggagaccaAGCTGGCGTtcaaggaggaagaagcgcggCAATCCACGCAGACTGTGGCTGGCCGTGTGTCCGTCTTCAAGTACTAAACGATTT
CCCCCTCGTACCATGGTCAATAGTTATTCCACACACGCTTACATTGACTGGTATTTGTTTCCTGGCCTGCCAGTCTGATTTTGCATGACGCCGTTTGCAC
CGTTGTTTCTGATGTGGGATCGTGAATGCGAGCGGCAAATCGTTTCTACCCACGTTGAAGGTGGCGTTGAAGTTGGCAATAACAAACAAGTGTTTTCCTA
TCCCGCTCGGCCAGTTCAATGCATTGCACGCAGTCTCCATGCTTCAGATACCATAGCTTTGAGAGATGGACATAAACTCACTATATACAATGGATAGACT
TGGGTGACCACCAACTGACCAGGCAGGCAGGTCAAGCACCAACAAGTGTTTTGGTTTTCAAATGCCATCGTATTCGTTCGTTCGCTCCGCTaggtctgct
gctggttgccTACCGTCACTAATCCTACCTTTTCCTACTTTACATCCTACGTCTTCGCTCTTAATAACTAACTTAAAATCTGGTCTCTTCCTACATCCTA
CATCCTACGTCACTGGAGTCAAATATGTGGAACGATGATGATAGAAACTGTCTTCACGACTTTGGGGTGGAAATGGGTGGGAGCTTCGTGGGGGACGGGG
GAAGGAGACAACACACGCCGAGATTCGCTGAGGCTTTTTAAATAACAGCGTCACAGTCGTCTATCAGTCGGGATTGCTATTTAGAAGCACAGGTCCAGCC
ACGGCATCatgtcctcctcgtcgttcAAGGGCGACAGTGGGACTTCCCACGCGCCAGGCTCCACATTGGCGAGGTCCATGAGCACCTCATTCTCAAAGCT
GGCGGAGTCCGAGGTTTCCTGACTCGTTAGAACAGGGGAAGGCTCCAGGCTCGAATGTGTCTCCTCGTCAAATTTTAAGCAGTCACGCGACACCATGGCA
CACTTTGGgttcatgctgctgctgctgttgttgcctcCACTCAGTCTGTCGTCCATTTGTCCTGGtgtgatgctgcagtcgtcggTTAAAAAGTCTTGAA
TGTCAATGTCCAATGGGGTGGAGAGACCGCTGGATTTTGACGGGATTAGGCTTGTTGTATCCAGTAAATCTCCATAGATACACTCGTTCTTCAAACTCAA
AGCAGACGACAGTGGGTACAGGTGGTCcatgtccttcttgatgAGACCTTCACTCAGCATGGAGCCTCCCAGGTCGACGGATGGGGGGCTGGCTTGAATC
ATCGCTGGTTTCAATGCTGGAGACATGTTATCTAAAGCGATAGGCTTCGCCATCGGTGAGTAACACGTTCGACCAGATACTGGCGCCAGAGTGGGGGTTT
GAATGCCACTTAGACTGGAAATGTTCACTGGGGTGTGGTCGCTGGGCTTGGAGGCGGTGGCAAGGGGGTCAAACCACGGGTCTTTCGCCTTGCCGGCGCC
CCGTCGCTTTATGTGAACCAGCAAGTCTGGGCGTCCCTTCCGGAAGAACGAGTGCTGGTAAATGGTCAGCTGCCCTTCTTGCACACGGTAGAAACTGTAG
AAATTCAACTGGCGGATGAGACTGGAAAATCGACGGTGGCGAAAATACTTTGGCAGACAATGCTctgccatcatcttcgagTCTACAATGCAGAACGCAG
TGCCACCTGGAGCATACGATtaaacagcaacagaaaaaaGTAAGTACAGGAAGTTGGGCAACTTAGCCTAAAACGAAATATCTAAAGCAACAAGTAGAGG
GAGGGGGAGagagggaggggggggggcaCACACCTCGACACCATGATACGATCGAAGAGGGTTCGGAGTCCACCATGCGATACAATTTGCTGACAAAGGA
gccggagctgcagcactcgcGCGGGATCGAGCACTTGTCGCTGAAGTGTTGCATGCTCTGCGCGCGCGGGCGTCGGCTGCATGCAGGGGTCAGGGGCACG
GGGCCTGAGAGGGACGTCACGTCCTTCATGTTGGTTTGTTGTATGTTGGCTGCGGCGCCGAGCTGAATGTCTTGGTCTGCCTTGGGGCTTGGCTGTCTTT
TTGCTAACTGACCAGAAAAAGGTGCGGGTTTGCGCCAACTCCGACCAAAAATTACCATCCAAGCCAGCTGCGTTCGGTTCTACACTTGCTTTCAGTAAGG
CCAAGCccatcttcaatgtcgtgGAGAGAGAGGGCGAGTTTAGGGACATGAAAAATCAGCCGTGGAGAGCTCCTATTGGGGGTGGATCCAGCCAATACAC
GTGCGTCGTACgattttcaaccaatccaaACACAAAGAAAAATCTTGGGGACCTTCATTGATGTCGCGATACACTCATTCCAGATGTAACCTCTTTCATT
CGATGCACAACCTGCTATATCGTATCGCTGAAAGCAGTCCGTGGGTTGATGACGAGAAACCCATGTCCAGAATATCTTGAACAAAGCATTTAACCCAATA
TCCACTAAACGCGGGTCCTGAACAGAGCAAACCCGTTTTAATAAAAATATAATATTTTGTATGCGACAAACCCGCGGGTCGGATCGCACATCATCTTCCA
CCCTCTGCGGCCATGAAGGATGATGGGCCAAATGGCTACCCTTTGCAGTCGGCTTTACAGGAACAGCAATCGGAAATACGCACTCTGCGAGAGATATTAA
CACTCCTGCCCAGGTACGAATTCAGTCGTCATGGGCCTCTTACCCCTCGGAGGCATTGTCAGGCAAGCAACACAGGCTAAGTAAGGAACGCGCCAAAAGT
GTAGGTTCAAATCATGTGTAGAGACGGTGCGGAGCATTCGAAAAAAATGCGTATCTTTTCGAACTCTCACTTGAAGCGATCGACTAGCAGTTCGCTTCGC
ATCGCATCCAGTACTACCgctcgctgcagctctacCACTTGATGCGGCCATTGTTTTGCTGACTTCCTCCCCATTGCTGAAGCAACACCTTGCAACCTTG
TAGCCTTGCAGAGCCAACACACAAACGTTTAGCACGAGCGCATAGCTCGccaaaaacaacaaaaatcGTCATCTCGATGCAGCTAGCCCCTCCTAAAACG
TTATGCtacaactgctgcaactgctgtAACGGACGGGCAAATTTCGCTGAAGTTCGAACTAATGGTGCAACTAGTTCAGGCCGTTGGTTATACGGTCTTG
CCGGGAGAGACCGCCGCGGTGCTATCTGCAGCAAATCAGCCCAAGCCGTTGGTAGCCACAAATACACGTGTAAAACGGCACCAATATAGGTAGATCATGG
ACTACGAAATTGCGGCTGCCTAGCTCTGTCCAGGTACACTCTAACTTatacatgttgaagttgccttcaacttcaacgtcgaAACCTTTTCAAAAATAGT
GAAGCGCCTCGTCTCACGATCCAGATGGCGATGCCTCCTAGGACTGATGGCCTTACTCGTTCAGCTCCTTGGCCAATACCACGTAGTCTACCTCCTTCCT
GGCGCGCTTGCTCCTGGACCGCCCCGTAGAAATCGCAGCGTCGGCTttcacgcgcttcttggtTTGCAGCATGACTGCAGGGGCTGCTGGGGCCATATAG
TTGGCCAGGAGAGCCTGTTCGTGAGCAGCCTCTTTGGCGATCTCTTCCTCATCCCATTGCTCCTGCGCTGGGTTGATAAGCGCTCGCGTGTGAGCCGCAA
CACTACGTGCGAAGGGCGATACCATACGCCCGTGGAAATTGTAGCCGCCCTCCAGTACTGAGATCAGCCTGCCATTGCAGCACGTGTTGGCGATCTGCTT
CACGTGACCCACAAGCCACTCGTAGTCCTGCTCCAGAAGCGACACGTACCCCCAGTTTaccagctccttcttgtgTGCGTCAAAGCCAGACGACAGGAAA
ATCAGGTCTGGGCAGAACTCGCGCAGCTTCGGTAGGATGTTGTCACGGAAGGCGCTTCGCCACTTGAGGCGCGAAGGCGCCGAGCCCTCGTA