Description :
From Genome Similarity Track
Location :
Scaffold_62:101148- 107658
Transcript NameFunction/comments
Sapdi_VS20SDRG_13646hypothetical protein
Sapdi_VS20SDRG_13647hypothetical protein
Sapdi_VS20SDRG_13648succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial

Sequence
6510 bases(100 bases per row)
AGCTGGCCAACTATTCGGAGCACGATCTGAACCATGACACGAATGCAAAGCACCGCGTCTTTGGACATCCTCCCTTTACGGTCAAGGACGGGTCCGTCTC
GCTCGCTGAGTTTGGGCTCCTAACAAAGTACGTAGACTGCGGGACTCGCCCGCCAAGACCTTTCTCGGAGCGATGGCCCACCGACCAAACTTTGCGCTGC
GACTTGGCGCACGCGTCGAGCAAATCGTGCATGCCAACGGCAAGGCCACCCACGTGCTCTACAAGGAAGACGCTGCCAATGCGGCATCCGTACACGATCT
TTCGGCTGCAAAATACCATTTGTAATCTATGGGTAGGTGATGCATGAAGCCATCCTCAGTGCTCGCGGCGCCGTCCTCGTGGCCACGGGCGCGCTCTTGT
CGCCGCGTTTGCTCCTGCAATCGGGCATCGGCCCCCTCAGCCAACGCGACCTCGTGCGCATTTTCGTTCCTGTGAATGAGAGGGTGACGCAGCAAACATA
GGTCACGAAGCGTCCGCTGCCGTCGCCGCTTCGAGCGGACGCGTGGCTGCAGAACGAGAACGTGGGCGCCCACATCTTTGACGCGCACCAAGTGGCTCTG
ACGTTCCGCACAGCCAACGTCTCGAATAGCTCGGGCTTTGGCTTTGACTACATGCGCCCGTCGCCCTCCGTTTTGGACCAGTTTGTAAAGACGCGGTCGG
GCCCCATGGCGAGCGCCAACCCTGTGCTCATTGCGTACGAGACGGTCGCCGATGCCTTCTCGGGCCACAGCTTCCAGTTTCAGCTCTCGGTCTTCCCGCA
CGTTATGCCCAACCTGGAGTTATCGCCGCCCGCGAACGACCAGGAAATGGACTGGACCATTTGCTTTACGCTCAACAACCCGCTCTCGCGGGACCGCGCG
GGGTTCTTTCCCAACGGAAGTTACTCGGGAGCGATGGCGGGGCACCTCTACTGGTCGCACCCGGCCGACGCGCGCATGATGGCAACGTTCATCCAGAGCA
CCATCGACCAGATTGCGGCATACTCCAAGCAGGCGACCGTCCCCGTCTTTCCAGCGCCTTCGGTATCCCAGAGTTGGTGCTGGCGGAAGAGTCACGTCGT
GTATGTAGGCGCTGCAGTGGGCGACGTGGGCGACCAATCGAACGTCGTGGATTGTGCAGCACACGCTTATCACAGATCACTTTGGCGGCGCTTGCATCGT
TGCGTCCAACCGCAGCAACGACCGGTGTGCGGACGAGACCTTCCGCGTGCTCGGCACATCCAACGTGTTTGTGGGCGACGGCAGCGTCGTCAAGAGCGGC
AACGTCAACCCGTATGGCTTTGTCATGTACACGGGGTACGAGGCCGCCACGCACGTCGACGCTTATCTGCGCGCGTGACCAACTAGACTTTGCATTTGAA
ATATAAATTTACGTGTATATACCAACGATTTAGATTGTTCTGACCGCGCGTTCGACGAAGGGTAGTAGGGTTTACGGCTTGTAGCACTCACGACCCTCCA
GTCGAGTTGATGTGATGGAAGGGCGCGTGCCTAGCTCTTTTCTCCACGCTGCATGACTGTTCCAACGCCGCACATGCAGCTCGAGTAGGAAACAAAGAGG
CCGGAAAGGAATACACGTTGCGAGAACGTTAAGTTGCTTCGAGGTCGGACTCGGAGAGCTACCGACACCCCATTTTTGGTCACGCCACGTGACAAGAGCT
ATCTGTACCTGCAGCGTGCGGGCGATGGCCTCGGAAAAATTGAAGCGGGTGCGCGCCGGAGGCTTCCCGCGAACACGCGCGCCCGCTTGTTTCCTCTGAT
CGCTTTATCAGTGCCGAGTGACCGTGACATATGCGGAAGCGCACCACTTGGTTGACTTTGATGGGACTCGTGGAGGCGATCGGGAGAGTCACGGGCGGCG
ACGGAGACCCGAGTGGTTTCTACGTTTCTGTGACGCCAAGTTCAGTAAGCACTCGCACCAATGGCTTGAGGGGAGAAAGCGGCAAGGGTGGCAACGATGT
CGACTCGGTGGGTCTACGCACCGGCACGGACATCCTTTGGCTACCAGCATAGTCGTTGACGTACGTGGAAGGCTCTTCTTGCAGGGTTGGCGCGCTACCG
TCCGTGGTTGTCTACGCCGGCGCGTGCTTTCCACATGTGCACCACATGCCTTACGTTGTAGTTGTGGGCTTTCAGGCGCGAGTTGCGACTCGGTATTCGC
TTGCTGCCGTGCTTGACTTTCTTTCCTGGGTACACGACCTTGACGCCGACTTCGATCCGCCCCGTTTCGATCTGTGGCAAGTGAAAGAGCGGCAGAGGCT
CGCCCGGTGCTGGCTTCTCGACCGACGGCTACGCAACCCGCGTCTTCAGACGATGCAGCAACAACGGCAAGTCGAGATACCTCTGCGACGGTGGGCACCT
GCGACGGACGCCGGTGCTTTGGCGACGGTTTGATCGACGGCGACCGGTGGACCTCGGGCGGCGCGGCTTCTGGGGTTGCAATGTTGTACGGAAGGTCCAA
TGTCAAATGCAGCGGCAAATTGCGCAATGGCGGGGCTGCCGCCGAGATGTGGCCGCCGTCACCGTCGTGGTGCGGTCGTTCAAGGAGCTCCTTCTTGCGT
TTGGCCACGAGCTCGTCGTGCTGGCGCGTCGCTTCAACGGCTTCGAGGTACGCGAGAATGTCCCGTCGGCGGGCGAGCTCTCGGGGCGACAGCTGCCGCG
GCGTGCCGAGCGAAAAGATGTTGGAAAACGTCGTGCTGTCAGAGGCGCGGTCGTCCCGCGTCGCGTCGAGCTTGATCTCGACGTCCTCCAAATTCAGCTT
GTTGGAGACGATCCCTGCTGCGATCGTGATGCGTCCGCCACGACCAACAAACGTGCCGCGGACTGTCGACTGTTTGTTGTTATCGGGTGACACGGGTGGC
GGCTGCGGCCGCGCGGGTACCTCGTGCGGCGTGTGTACGTCCATGGGGTAGCTCTTCGGTTCCATTGGGCACGCAAAAGCGACAGTTGGCACAAAGCTGC
TCGTGCGCACCGCGCTTTTGACCTGTTTCTCGGCGGCCTTGAGTGCTTTTGCGCACACCTTGGTCAGTTCTGGCGCCGTGATCGATTGGCCGTGGGCGTG
CGCGGCCATGAAGGTCACCTAGGGTGTCGCCTCAAGCGCTTGTTGAAGGAGGAGACGGCACCTCGGCTGGGGACAAGAAAAGTGGGAGCGACCCTAGCAC
GGAGGCAAACTCGACGTCGCCGCAGACGTGCCCGTCGCCGTCGATGCTCACGGTGGCAACAATCTTCCGGACACTGGTCGGGTTTTGCTGGCAGTAGGAG
AGCGTTCGCTGAATGGCGTGGACCAATGGCGCGGTATCTGTCGCTGCGTGGACGACCGTGGACACGGGGACGTCAGCACACGCGTCAAAGCTCGCCGAGC
TGGCGATGGTGATCATGGCTTGGATGTCAAACACCTCTTGCACAAGGCGCTGGCTCACACTGCGCAGCTACAATTACCACAGCCCACGTGAGCGCAAGCG
TCCGAGTACTACGATGCCACGTACAACTGCGGCGGTGAGTGCCGTTGTTTGCGAGATGACGCCGACGTGGTCGATGACGTCGGCGAGCATCTCCATGGCC
ACGTCGTCGCTAGTCTCGAGGCAGAATGGCTTGCGCTCGTCCGGCGCCTCCGTGGGCGCGTCGGCGTCCATCGTCGGTGTGCCAGTGCTGGCGACGGGGT
CTATTTCAGTGCCACGACGGAAACGCCAGCGACTAAATGCAGACAACGAGGAAAGTGCAACCTCGCCAAGGCAAAGTCGACACGAGGCTGCATTCTGCTC
TGACAAATGCGCCCACCCATGGCGCTCACCGCTCCATCGACGCCCCAAGCGACTGCTCACATGGAGGTGCTCATTCGCTGCATACAGCCGGCTTGAAGAG
TGGAATGCGCAAGCACCTACATCTCTTGTTCTCAACGTGCTTTGCCCACGCAGCTTCCATTGTCGCCGCATTCCCGTTGTACAGCGGCCCAGGTTTGCGA
ACGACGAGAGGGCGGTGGTGTCTGACTAGTTGTCGAGTGTCACGTGTATTTCGGTGCTGCATGCACAACTATATTATGTCACTGCGCGAGGACTAGCTCG
ACCTAATGCCCCACGAGCTCTTCTGTTTCGTCTGTCTCGAGCGGTCCTGGGACAGAGGCAAGGATAACGCATGGACTTCGTGTGCTTTCGTGGCGGTGAT
GATCGCCACCGAAGTCCATATGCGATGGAACATCGGGCCGGCCCACGACCGGCCTCATCGCTGCCGTCGTCACCTCCATGCATTCCGCCCACGACGGACG
ATGACGTGGCTATGGCTCGACACTCTTTGGATATCATCATTTGGCGTGTTGAAGGCATGGTCAACGCCGCAGCCAATGTAGGTACCGCGAGCGTACGATC
ATGGCCGCGTTGCCATTGGCTTCAACGGCTTCATCGCCGACGTGGGCGCTTCCGTGCGATGGCTCCGTGCGATAGCGAGGTACGAATTACCGAGCGAATT
CGTCGTACGCGATCGTTAATTCCGGCGCGCGCAGCTACTGCGGGGCGGCGGCACTCGACATTCCTTGGCATTCGTTGCCATTAAATTGGCGCTTGAAGAT
ATTTTAATGACCTATTACACGTCTTTTAATTGGGTGAGCATACAAAGACTAAGTAAAAGGATGTCCAAGGCCGTTTGATTGGGTGCATATTTTTATTCGA
CGCCACCCCAATGTCATATTATTCTGTTTTTCAGCAATCTAGAAAAATAAAATGTTATCTGCATGATATACATGATATTAGTATGTGAGAAAAAGTATTG
GAATAATAATGCGGCGGCCCATTGAAAAAAGGCCGACCACCACACAAATCCCGGCAGGCGTCAGTTGGTATTTTCCAGTCGTAGCTCATGTTGCAAGCCA
CTTCCAAGGCCAAGGCCGCGATCTCGCGCGCCCTGAAGACCACTGGCGCCCGCGCCGCCTCCACGAAGGGCGGCTACACCATCGTCGACCACGAGTTCGA
CGCGGTCGTCGTCGGCGCGGGTGGCGCCGGCCTCCGCGCGGCCATGGGCTGCGCCGAAGCTGGCCTCAAGACGGCGTGCATCACCAAGCTCTTCCCGACC
CGCTCGCATACGGTCGCTGCGCAGGGTGGCATCAACGCTGCGCTCGCCAACATGACGGAAGACGACTGGCGGTGGCACATGTACGACACGGTCAAGGGCT
CGGATTGGCTCGGTGACCAGGATGCTATCCACTACATGTGCAAGGAAGCGCCCCGTGCTGTCCTCGAACTCGAGGCCTACGGTCTCCCGTTCTCGCGCAC
GGACGACGGCAAGATCTACCAGCGCGCCTTCGGCGGTCAGTCGCTCGACTTCGGCAAGGGTGGCCAGGCCTACCGTTGCGCGTGCGCCGCCGATCGTACC
GGCCACGCCATGTTGCACACGCTCTACGGCCGCTCGTTGGCGTTCGATACGTCGTACTTCATTGAGTACTTCGCCTTGGACCTCATCATGAACGACGCCG
GCGAGTGCTGCGGTGTCATTGCCATGAACATGGAAGACGGCAGCATCCACCGCTTCCACACCAACAACACGGTATGTAGCGTCGACCACACCTGACTCGA
GTGCTCATCAAGTTGGATATAGGTGCTGGCCACGGGTGGTTACGGTCGTGCGTACTTCTCGTGCACGTCGGCGCACACGTGCACGGGTGATGGTACCGGT
ATGGCGATCCGCGCCGGTATCCCGCTCCAGGACCCCGAGTTTGTCCAGTTCCACCCCACGGGTATCTACGGCGCTGGCTGCTTGATCACGGAGGGCTCGC
GTGGTGAGGGCGGTATCCTCCGCAACTCGGAGGGTGAGCGCTTCATGGAGCGTTACGCTCCGAGCGCCAAGGACTTGGCCTCGCGTGATGTCGTCTCGCG
TGCCATGACGATGGAGATTCGCGAAGGCCGTGGTGTCGGCAAGGAGAAGGACCACATCTACCTCCACCTTGACCACCTTCCGGCTGAGCTCCTCGCCGAG
CGTCTTCCTGGTATCTCGGAGACGGCGGCCATCTTCGCCGGCGTCGACGTCACGAAGGAGCCGATCCCGGTCCTTCCGACGGTGCACTACAACATGGGCG
GTATCCCGACCAACCACTTTGGTGAAGTCGTCGTCCCGGACACGACGGGCCTTCCGGACGCCAACCAGATGTACCCCGACAAGGTCGTCAAGGGTCTCTT
TGCCGCCGGCGAAGCCGCCTGCGCGTCGGTCCACGGTGCCAACCGCCTCGGTGCCAACTCGCTCCTCGATATCGTCGTGTTTGGCCGCGCCTGCGCCCTT
CGCATTGCCGAGATCTCGAAGCCCGGTGAGGCCAAGCGCCCGATGCCGTCGAACGCTGGCGACGCCTCGCTCTCGATGGTCGACTCGCTCCGCTACGCCA
ACGGCGCGATCCCGACGGCCGACCTCCGCCTCGAGATGCAGAAGACGATGCAGAACGACGCTGCTGTCTACCGCACGCAAGAGACGCTCGCGGAGGGTGT
CGAGAAGATC