Description :
From Genome Similarity Track
Location :
Scaffold_240:10112- 17662
Transcript NameFunction/comments
Phyta_totarag6048hypothetical protein PHYSODRAFT_462099
Phyta_totarag6049deoxyhypusine hydroxylase, putative
Phyta_totarag6050hypothetical protein
Phyta_totarag6051hypothetical protein PHYSODRAFT_351929

Sequence
7550 bases(100 bases per row)
ATTCCTGTCTGATCTGCAGTTACGCGCTTGATCGGAGAGGCGCAGTGACGTGCACTTGACACTTGCTGAGCGTTCGCCTAAACCTTTAAACGTTGTCAAG
GTTGCCCTACGAATGGCTACCTCTTGTcctgccagcagcagatttAAAACCTCCATAGGATCTACGCAGCTGCTTCGGCAGGAATCCTGCCAGGATCGTA
TCCGGgctcacttcaactccaGCGCAAATTGTGGCGCCGGCGTCTCCGGTCACGCTTGGACTGCAGCCAACAACCGCCCCGCCCCGCTCATCTCTCAGCT
CAGTGATGCAAATCAGCTCCAACATCCTGCGTGGAGTCAACACAGATCACGACGCCGCCACACAGGCTCGTGAATCACGAGCGTGTCGGCGACAATTTGT
CGCCAACAATAACGGCAAGCGACCGTTCGTCTATCCATCGATAGATACATTTTGTGGTTTACTTAACTTCGATTATGAGGTCCACCACAGTATGTATCTA
TCTCACCAGCGAATAATGGAGACCGAGGCCAAGGCGCTGCTCGCGGAGCTTCGCGCGGCCGAAGAGGAGCACGAGCGTGCGCTCGCAGCCGCGACTCATG
TCCGCGACGCTTTAGACCGTGCGCGGAAGGAGTACGCAGACGCGCGCACCGCTGAAAAGTCCAGCGAGGACGACCTGGCGCAGGCAGCTGAGCGCCTGGC
CCGCGGTCTCCAGAGCCTCGACGTGAGCGGACAAACGGACGCCAATACAGCGGATCTGCAGCCTCTGGTGCCTCAAATTGTAGATTCACTGGTGGAATAC
CACGCCAACATCGGCTGCTACCAATGCTATCTCTTCCTAGACAGCCACGAAGACTGCGACAAGCAGGCGGCGGACTTTGATGTTGGACAGCTTGGTGTTC
GAGTGAAATTCCCGCGCGTAGAGCTCACGTACAGGGTCAACAATGGTgggcgtggtggtggacaagttggagagcaggaggagggTGTGGAAGTTGTCTG
GTGGACGGAGATCGAGCGGAACGTGGACGTCTCGCAGTGCACCGtcgaggacaaggaggatCATTGGTATTTGAGACTTCCGATCCGACCAAGCGACAAG
CAACCGCTGGGTGGGTTCTCATCATTCACGCAGGTGTCTCCTGTCGAGCTTCGACCGGAGAGTTACGCGTCGGTGTGTTGTCGAGGGTGCAGCGCACAGT
TGCTTGGTGGAGAGGGAAGCACAAAGATTGATAAGGTTCTGCCACTGCCGTCCGCGAACTGGATGGACATGTTTGACTTCTGGGGAGCTGGTATTGGAGC
TTTTGAGCATATTCCACGCGATGATATTCACGCACAGCAGTATCGAGTTCTCGTTGGCGAGTCGtatgtgctgctgcacgctaGCGACTTGGTGGCCGAA
GCAACGGTGGCAGATTATGAGGATGAGGCGGCTGTTGCGCCCGGGGATAACGCGAAGGAAGAGCGCGAATGGGTGCCATTGACCTGTGCTGCGTGCTCGG
AGCGTGTTGGTCTGCGCAGCTTGGAGCAGCCAGAGACTGTTCGCCTGCACAAACACATGATTAGTGCTCACCGATTGctagaagctgctgggcaagaGCA
AGTGAACGAAGATATCTTCGGCAAGTACACTATCGACAGCATCCTAAGCGCCAAGTTGTTAGAAATGGCAGACTCGGACGGCATTTTCCGGTTCGTATTG
ACATTGTCGGACGACAAGCATGATCACGATTTTTCGTGTGAGAAGCAAGGTGGCGCCGCAGATGCACCATCAACAGAAGTGCAATTGCAATTGCTTAGCT
GGGAGACGATGATCAAACAGCAGGATACGAATATGTTTCGTCGCGTACTGAAGGTTTTGTACGGTCCTCGTCAACCGATGCCCGCGATTTCTGGGCTCTT
GCCTTCGCACGAAGTGTCACTGCCGCCGGCCATGTGCTTGGCCATCGCTCAGCGACTTCAAACCAGCTCGACACTGCTGCCGTCTTCACTGCGTGCATTT
AACCGGATGAATGTTGGCTATCTCTTCGCTTGAGGTGCTTGCTCGCATTGCAGCATCTTGTTAATAATACCAAACGAAGTCAACGCTGATGTCAAATGCA
AAAACGAACTGTATTATTCCTACACGTCAGCGAAACGCGTTCTCTTACCTATCAGCGAGCGATGCAAGCGCTTACTTGGTGGGTGCCCAGTAGTCCATGA
tgtccagcgccaccacgcaGCTCTCACGCACGACCGGGACGTCGTCCTTGAGGTGTTCCTTGAGGATGTCCTCGCACTCGGTGGTGCCAATCGCTCCCAG
CGCCTCGGCAGCCTCGTGTCGCACCATCCGGTGCTGCGtctcatccagcagcacctttTTGAGCGCCGGCACGAGCACGGGGTTCTCCATCTGGCCCATG
ACGTAGGCTATCTCGTGCTTGAAGAGGTCGTTCGGGTCGGCGAACGCCTCAGCGAgggccagcgccgcctcctccgtgTTGCGGTTGCGCAGCGAAAACA
TGGCGCGGTACTTGGCGAACATGTCTCCGTTGTGGTCCAGCAGGATCTTCCGCAGCTCGGCCGTCGACACATccttctcagcagcaggGGCCGGGTCCTC
AGACAGGTACGGGTTGCGGTCCACTTCTCCCTCCACGATCTCGCCCTTAGCCTTGGCCAGCTTGTACTTGACCAGACTGGCCGCCAACTTGCACGTGTCC
GCCACTTCGGGCGCCGGGTCGGCGCTGAACTTCTCAAGCACCGGCAGCGACTGGGCCGCGCCGATGGCGCCCAGAGCCTCGGCCGCCTCGTGCCGCACCA
TCCCGTCGTCTGTCTCGTCcgccagcaactgctgcagcgtctcacacgcctcctccagctggaACTGACCGATCACGTACGCTAGCTCGTGGCGCATGAG
CTCCGAGTCCTTGcggttcagcagcgccgccagcagcacctgcaggTCCGCCACGCTGCCGCGCGAGCGCAGGTAGAAGATGGCGCGCGTGCGCTTGCCC
GCGGGCTCCGACAGGTCCAGAAGCGCATCGCGCAGCTGCTCAAAGTTCGGCGTCGTGTCGGGCACGGAGGCGATGGTCTCAGTTACGGACGAGTGCAACG
GCATTGGAGCTTTTTGCAAGTCTGGAAATGGCTACAGTCTCACTTTGGCCAGTCAAAAGTTGTTAAAAAGAAATGCTACGTCACCGAACCCTACGTGTGA
CTGGTTAAGTTAAAGTAAAGTGCCTCCAGCCAATAAGAATACAGCACTGGTCTGATTGGGTACACATTATTGtgtacaagttgaagcaaaaCTGGACACG
CAAAAATGATCAGCGATAAAATATAGTTAAGCTTACGTGAGATTTCGGAGAGTTTTGCGCTCGTTGTGGTTGGTGCAGCTTTTTCATTCCGGGTTCTGTC
AAGGCCATTCCGACGAAAAAACACGAAGCAGCGTCTCGTCAGCTCCAACAGACCACACCCATGTCGTTTGGAGAGATTGCGAGGTGCAAAACTCGCGCAG
TGCAGTCCGTGAGCTCGCGCACTCGCTCCAAGGTCGGATATCGCCAAAGCGCGAGGTGGTTCGTTGCTGAGCCGTAAGATGGCAGTTGTGGTTGACCAAA
TTAAATGAGTGCACACACCTGCGAGTCCGCGCGCGATGGTGATGCTGTTCTTTGCGCATCGGTTCATGAACTTGAACGCTGAGGTCCCGAACTGAGCAGA
ACGTAGGTCGAAGGACGCCCTTGTGGAACACTAATGAATCTCATTGACAAAAGACGTATCGTTTCCTTCAGCAGACAAACTCGTTTGAAACAAGACTATT
TTTGTCACGACTGACGTGATCCATGGCGTCGCTTCAGTATGTGTTTTCACAGTTCACGTTGgcacatggctacatcaatGACAAACAAGATTTTCATTCG
CCTGGAAAAGGCATTGGCGGAGACCATGTGCATGACACTCTGTGCCATGGCCTCCTCGGTCCTGCGGACGAAGTCCTGTTCGCCCCAGTACGTCGCTCGC
TTTCTCGTTCTGGATGCCGACGTCTGTCTACGTGTTCACACAAATGCTTTGCTCAGGTTTCCTACTCCCGTCACCTCTAAGCGTGACGATGTTGCCGATG
TCGCTGATGATGCTGGTGATGAATGGGGCATTGTGCACAACCCAGACAACCAGCTGACGCGTTGTCAGCCTTGTCGTGTGCGGATGGTCACCACATTTCG
CGGTGTTCGAGTTTCTTTGGTTATCGCAGTCGTAACGTCTCCCCATGTACCTCAAGACCTCCATCTGCAGCGGACGCGAGCAATTTGGGCGTTCTCTACT
ACGGGATCCTACCCACTGCACCCTCTTCGGTTCGCTCAGGAACCAATACTCGGTGTCGGTCTCCTGACGTCGTCACACTTCAACGCGTACGTGTCGGATC
GACTAGAGTTTGCTGCTCGCCGTCACTCTGAGTGGACAACAGGTAGCAGGCTGTGCTGTGCCCCACGGCTTACACCTGATATAATGAGTATGCCCGCTAA
CCTGGCTAGCAACAGCCACGAGCAGTCTGCTTCGAGTGCAGGCACAGCGGTGTCCAAGGAACTGGCACCCATTGCGCAGCTGTCGACGCAGCCGTTTCAG
TACGAGAACCGTGAGCCGAACAATTGCCTGGACTACGAAGAAAACTGTCATGCCGCCCACGCTGACATCATGGCCGATAAGGCAACGAAGAATTCCTACC
TGCCTTGGGTGCAACCGGCCGACATTGACCCCCGCTATTTGGACTACGAGCAGTCCGTAAGGTATTCCTCCAGACGCCGGGAGAACCTCGAGCGTCGTCG
TGCTTTGCAATTCTCGCAACGCCAGCATATCAAGGCTAACCGAGACAAGCCCCAGACATTAATTGTGTGATTAAGCACCATCAGCACGCCATCGAGGTGT
CGGTGAGATTTATGCGGCGTTAGATGTCATAATATGATCAAAACGACTCAATAGCGTTCGTTACGTCTCTGATTCAGTGTTGTGTCAATAAAAATTGGAA
TTAAAAAATTGGAAAAATTGTATCAAACAATCACAATTAGTAATTGACGATCAATTACTTAATTGTATTGGATATCCAAGTGACTTGAAAAATGTAAGGT
GAGGGCGTGGAAAATGAGCCAATCAGATGAGCGATAGGGGTTGCAAAGCCTCCAATACAAAAACCTATATAAATTTCAGGACAATACAATTCCAACATTG
AACAATTATCATTGCGCCATGAATGCAAATCTCAATCAAATTTTCAATGTAAATTGGCTCAACGCTGCTCCGATTGTCGATTCGAGCTAGAATCTCAACT
ACCCGAAGTGCCTCACTTTGCTCTACCATTCACAAATGTTGCTGGTCGCGTGGagcatcgtcgtcgacgtctcgAGCACCGCAAAAGATGTCGTGGCGTT
GTCCATTCCGAAGTGCGCAAAGTTGCGAACTTCCCCTGCATTCGTGTTCAGCAGGATGGTTTTGCCCGTGCAGTTACTTCCTGCGTAGAATGTGATCTTC
ACTTGCCTATCGGCAAAGGTTGACCCCGTGGCCGGGAGTCCCATCCACCTTGCCGAAGATATAGCGCCACTGAGATCAGCACACGGCATGTCGTAGCAGA
GATTTCCTGTTGAAATCCCGATGATCCGACGGAGCCTCTTGAAGTCTGGCTCCTTGTAGATCCGCAGCTCTCCCTTCATCGCAATCGCGTCTTTGACACA
GCAAGCGATCAGCacaaacgccaagaagcgagAATCCATAGGCGTCAAAGTCGGTCGAGTttcgtcgtgctggttgcGCTGCAATTTAAAGAgtgagcag
cttcacctgAACCATTCACTGGAAAATTACAAGATCACAGCACCTGAAGGCCCCACCACGAGCTCAGAGTCACACTCTATTGGCTTGCCAACACTTATGC
TCCCTCGTATGATGCCAGCCAGCTTTGAACTCCTCGTCCATTCGGTTTATATTTAACGTTACCAAACTCTTAAGACTTGAGCACGACTGGCTTATTATAC
ACGCGCGTGCATTGATCTCCATCAGCACGTCACGAATTCACCTCCGAAGTATAGATTCCGCAGACCTCGAATCACTCCCCACGTGcgtgagaagaagaac
atgtAGGCCGACCCGAACTCGCCATCGTGAGAGAGGTCTTGGTCCTTACCTAATTCCCGGATGCACTGCTGGTAGTGCTCCACGTTAGCTCCACCTGGGT
GCTCCGACGGAGCGTACGATAGACCGCCGTGCGAGAAAGATTCCGTGAGCGACTCGATGTTCCAGCAGCTATCGGACACGATCCGTCGACGCACGCCGTT
GCGGCTGAGCAAATGGGACAAATAAAAGTCATCACCTAAGAAGCACGCCTTGGACATGTTTGCGACCTCGAACGCCGGCATCGTCGCCTCCCTCATACCG
AAAAACTTCCGCTTCACTGCAACTCCACCCGCTCCTCCTACAAACGAAACGCTGTTCACACCGACCACGAGGCTGCGTCCGCAGTACAACCCGTCCTCGG
CCGAGATCCACCCTCCCAGCACCGCGACCGCGTCGTTCGGGTACTTGTGCGTGTAGTGCAGTGCACGTTCGCACAGCTGGGGCGGGTACACgcggtcgtc
gtcgccgtaTACAATGATCGTATCCGGGTCTTGCTCCACTAACAGCGTCCCGAGCACTTTGCTCGCGGGGCCAAAGTCCGTGTCCAGCACGATGAGCCTC
AGCTTGGCGTGGTACGGACTCGTTCCGGTGGCGAAGTTGATCCCACGGAACTCGGTGCGGTTCAGCGTCGTATCGTCGTCCAACAGCCACGACGGAATCT
TCACTACCTCGTCTCGGTACATCCGAGGGACGATGACATACACCgcgtcgaagccgtcgccCTCCTGGTGCACCAGTGCGTCCACCGTCGGCTGCATCTC
GCTGGTGCCTCGTGTGGTCGTCGTGAAGCTAAAGACGACTCGGGGTCGAGCCTGCGCCACATTCATGGACGTGGACGTCATGGCGGTGGATGAGTTAAAG
GTGCAGAGGAAGATGGTGAGCCACGCCAccgtcgtggccaagaagcacgcgAACCACCGCTTCCGGCTCGTGTGTTCGTCATCGGGCATTGTCACGGACT
CCACGATGACCTTTTCCGGCAACAGTTTCGCCAGTTGGCGCGTgcgtcggcgctggcgaCGGTGACGAACTAGCAGCAGTGTGAGCACCGCAAGCCCCGT
AaggatggagaagagcgagatCCGCGGGATCATGACCCGTTCGGCGTACAGGTCGATGCACGCGTCGCCGATGGTGTGGCCGGAGCTGCCGACGGACGTC
CGCAGCGACTGCACTGTCATTGTCGATGCTCTTAGCTATGCTGGTCGGAATTCCGTGAATGCCGAACGAGGCGGACGGATGGCTGGAACCCAAATGGAAC
GGCGCGATGCCGGCGTAGGCTGTCGCACGCCTCGGTCggcttcatcgccatcatAAGCAGGccaatgctgctggcatTGTAGGCACACTGCGACAGACTC
ACCAGCTGCTCGATGATTGCACGCGAAAGATCAAGTTTCTGAAGCAGTGA