Description :
From Genome Similarity Track
Location :
Scaffold_180:10112- 13460
Sequence
3348 bases(100 bases per row)
GCATGTAACAAATTGGGCCCGGACAGGTTTTCCAATCTCTCCTCAGAGTATAAGGCCAGGAAAGCGGTCAAACAACAGCGGGAGTTAGCTCCTGAATCTA
ATGTATCTGTCCTACTGATCGTAAATTAACACGAGCGGGATTCGCCCTGTAAGCTCTGCGCGCATACGCGCAATCCTAGAGCCACGGCTCTACCAATCGA
CAAGCGGTGACCTTACACCCCGAATGCCGTTGCTGAGCTAGCACATCAACTCAGAATTCGCCCTGTGGTCACACCGGCAACATGCAATTGTCTCGCCATG
TCGGTACCGCAGGATGCGAATATAAACGCCCCAGACCGGTCTTTAGAGCTACTAGAGACTAGCATAAAGTGTGGCATTAAGTACTTGGGTCGGCTAAATC
TCAAAAGCAGCTCGCCCATGACCATAGGGTGCATATTTTACAGAACTTTCACCGCGGCTAGCCCGGAATGTCGCGCACTGAGTCGGCCTCCCAGTTACGT
TGGTATCTGGAGAATTATGCGTCCAGTTCTTCGGTCCACACGGCTGTGGTGCCCGAGTACACCGGGGGACACAACACACAGTGGGAATAGCTGCCAACGT
TTTTCAAAATACCGTTTATGTCATTGAGCTTGTCCCCAGACCGACAAACGGATGGAGCTGTTTGAAAAATATTCCCACTACCGTCTCCTTCCATAATCGC
GTGGCCGAGACGGCGGCGGAATATTAGCTGCTCATTCTCGAGTAAATGGACGATGTATTCGCTGCTAAAATCACGATGCCTGAACGCCCTCAGCTCATTC
TCCAATATAGTGAGCACAATTATTCAGCATTTATTCACTCTAGCAGTACCGATCGACAGCCAGCTCTTGACGAGGATACGGATCTGCTTGATGCTATCTC
TCGGGACAAACCAGTGCTTTGGGTACAACCCACTCTGCGACACGGCGGGGACATTAGACTGATTGTTACCGGAGGATGCGACGGTCACTGCCCCTACTCC
TCCTATGGCCTTACCCAGCCACGACATACCTGGATCTACCGATTCTGCACTTTAGCCGGAGTTTAACAAGCGCTACAAGTGTTGGAGAACCAGCTCGCCC
TTCCTCCACTTTCACTCACGCCTCAGATCACGCCACGTCAAGCCTCACCTCCGGGTCGCAAACGTGGCCTCATCTCTTCGCCCAAAATCGACCGTTCGCA
AGGAACGATGGTGACTTACCAGCGCGTCACTGCGTTTTAAGAAAAAAAGGCCGAGTCGAATCGGCACCTTCGGACTCCGATACCAATGAAGGTGACTACG
GTCGCATCGATCGGGAGGACTGGGCTTCAGCGTGGGAGAAGCTGGCCACGTAATGGCCAAATACCAGGCACATCCCTTTTCCCACCGCCGACAGCTCCAC
GACGGAGTGGCAACACGTGACCCGGATAGCTCCTGACCATTTGATCTGGCTTTTCAAGCGCTTCATGTTTCCAAGGGAGTTGCTGCAGATTCTAGACGAC
TCGGTCGTTGAGATGTGGACGGTTGATAGCCGGCGGGCGTGCATCGAAGGGTCGTTGCGGCGCTACCGCAATACATTAACCGACCAGCCAACGAAAGCAT
GGGTTGATCGCTGGCTCCACAATATGCGGACTTCGGATCCCATTACGTTCGCATCACTGCTCGAAAGCTATGATGATTGGGAAAACTTGTAGGCTCGAGC
CTACGGGGGTGACCACCTGCTTCCACTCTTCTATCCGAAGCGTTGCTCCAGAATAATTCACCACATGCTCTGTGCCCTACTATACAACCATGAGATAGAA
GCCCTAGTAGGGTGCTCCCCATCTGATTTAGAGGTCCCGGATAATTTACAGGCTCAGATCAAGCTCATCTGCGACAATAACAGATACAAAAAAGCTTACT
ACACCTCCAATTGTCTTGGAAATTGGGCGGCGATTGAGCCGCTGACTCGTACGTCCACAGGAGAAAGATCAACATTTGTACTAATGAAAACTCACGCAAT
TTCTTCACGTCACACTACTACCGATCGGAGCTTGACCTCGCGCCCGTAAGCGAACGCTTACGGGCGTCACATTTTGTTACATGGCTTCGAATCCGAGTCA
TTCTAAATAGTCCTTCTCGACAATGGGAGCCGTACCGGCGAATTTTTACGCAAAACGTCCATGGCTTTTCAAAAGTTACACGTCAGGTGTGAATGACAGC
GTGGCGCCAGATCTCGCTGCATCGACGTGCTTTGGCGTGTTTCATTCAAGAAACGTATATGGTTAGTGTGGACGAAGCAACGGCACTGCAGCTCGAATGG
AGGCGGATGTGTGGCAGACATCTCGACGAGGACTAAGTACATATGTGTGGAGTGTGGGATCATCGACAGTCCGATGAATTGTTATTCTTCTCTCCCCCTC
GGTAGCATCAGCCCGCAATTGGAACTAAGGTTCACGACATCTGTATACTCAACATTTACGCACCAAATATTCGGGCTGAGCGCGAGGACATTTTCCAGGG
GCTCCGCGTTTAAAACATACCGTCCAGTAGCTTTGTCTTGCTGGGCGACTTTAATTCCCAGAGCCCGCAACCAGATATTTCAGGCCCACGGACAGCTAGC
GGTCCGGTAAGTCTGGCACTGAATTCTCTGTGGGAGAAGGCGGTCCTAAGTGATGCCCGGCTGTTACGATAGCACGCAGCGGATGACGACGAGTTTGACA
CGATTCATCACTACCCATACTGGACCGAAGCAACGGCTAGTCAGCTTGATATATCCTACGTTCTAGATTTCTGGGCTCTGGACGTCCTCTGGGTATCTAC
GCCCCCCCCCCACAGCCCTGCGATAACGAGTAAGTGGTGCTACACTTACGGGGCAAGCGTTTGGATGGCCTATCCACACAGAGGCAGCACATTTTCTATC
CTATCCATTCAAACCATCCCGACCGCGCCTTAACGGACATCATTCAAGAGATTACGAACTCGGGGGTAGGGCAAGCGCCGTCTGTCCGGTCCTGGGACAC
CCGTATTGCTCGGAGAATATACTGTATAAAAAGGTGATACGAGAATGGTAAAAGCAGAGGCGTAAACGCTCAGTTTTAAAGCTCGGCCGACGGAACAGGC
GACAGTTTTTAACTCGACAGCAATGGATATCCGCCAATGTGGAAGAGATGTGAAAGGAAAACCTGGCTCATCTCGGGGAGACTTAAGAGCGGACGAAGGA
GAGTCTCCGCTGGTCCTGCAAGCGTATTGCTGATTGAGAACGGAATCAGCGCGTAACTTCCCTACAAGCCCGTCACAGACCGGATTTCACGTGCACCATG
TCAATCGCAAATTAATTCGCATCTGAATGGGTATCAGTCCTGAGTCAG