Description :
From Genome Similarity Track
Location :
Scaffold_227:10112- 12054
Transcript NameFunction/comments
g15406.t1hypothetical protein
g15407.t1hypothetical protein

Sequence
1942 bases(100 bases per row)
ACGAGAACGACGCCACAGCCGGTCCTGCGGTGAACGAGAACGACGCCGCAGACGGTCCTGCGGCGAACGAGAACGCGAACGCTGGCGTGCACGTCCCCGT
GGCGGCGGAGGACTCCGCTGAGTATCCCCGCGGCGTCCGACGCCGCGATTAGTAGACTGGACCACCTCGGAGAGCGTGCGGCGATATTTGGCGATCCACG
ACTGTTCACTTTCGCTGAGCATCCGCTCAGCGACGCGACGCAGCTATTCTTCCTCGGACAAACGCTCGGAACTCTCGCACGACGTGCAGCCTTCGCGCAC
GTGGACGTAACAATCATGGTCGGACTCCCAGGCGTTCTTGCAGACGCATGCTCTCAGCTCGCTGAGAGAGTGTTCACCGACAACCTCCTCGCGACTGGTG
AGCCAGGCGACGAAGTTGCTCCCCTCCTGATGCATCCGGTTCCACCGGACGATCATTGCACACCACGACCGCTGCAGCGCATCGTGCGAGACACCCGTCA
GCGACTTCCCCCGCAGCGCACGAAATCGGCGGAAGTAGCCCGTCATCTCCTCCAGGGATTCTGGAGACTTCGCTCCCGACAAATCGTACAACGCCCAAGG
CTTGAGCTCCCGGTCCATAGCGCGTGTCCGCTGGGTGAGTTCCAGCGGCGGGTCCTCCACAATCGCCGCCATAGGTGTTGCCCGCGCTATCTCCGCTGCC
GAGTTGCTCGCGCGTGTTCCATCCGCAGGAGTCCCTGCGCTTGTGTCTGTCTGTCGCTCCATCTTGTCTCCGATCGCGCAATTCTGATTGTGCCTCTGCG
GTTCGCAGAGGTTGCTGCTCGTCGCCGTTGAGACCATCCCGTTGACGCCGCGTTCTCGCCGTTTCCCAGTTTTCTTTTCTTTCAGTTTTCTTTGCTCGCA
CTCACGGGCGTGAGTGCAACCTTAAGAGGGGGGAGAGTGATGTAATGTGCCCCTCCCATTTACATATGTAGGTAGATCTATATAGGTAGATCTACAAAGT
AGGTACAAAGGCACGCGGCTAGCGTGTGCCTCGTTGTCATCCTGCGATTGGTTGAAAGTGGGGAGCCAGACCCATTTCGACCAATCAGGTGTCAACCTGC
ATTTGAGTGGTTCACATGGATCCGAGGGCCACCCGCCCCGGTCCCAATAATAAACCGGAGTTGATTTTACCCTAGACTAAACACTTGGTCTCAGTATACC
TGAGCTTATTGGACGCTTCCTCACCGCTACGTGTAAGCTAGTGACGGGCACTCACCTGGCCCGTTACACCGAGCATGAGCGTCGAGCCGCATCGATCGAA
CAGGAACCGCAAGTCATCACCAACGTCTGTAGTGAGGACGACGTCCCGCTTGAGCTGCTGAAGCGCGACGACCGACAAAACCTCAGCGAGCGCGGTCGAG
ATGTGAAGTTCGCCGCCGAGCAGCGTCAAGACTTTACGTCTTCGCGTTCAGTGTCAGGATTGCCGGGTTAGCCTCGCCGCCACTCAATATTTGGTCCAAC
GCCTTCTGTAACTCCGTTGCTTGTTGCCTCAGCGACAAAATCTCGGAAGTCCTGGCAGTTCCAGCCAATAGAGCCTCGATGTGTTCTTTGCCGGGTTAAC
GCCGACCGGCTCCGTGGGAACGCTCATACGTGTCCACGAGGTCGGCGCAGTCCTCCGAGAGGCGGCTTCCAGACTCTCACCTGTTTTGTTCCTCTGAATA
ACCGCGCCACTTCACCAGATACTGTTAGTGACCGATACGCCCGCGGCGCTTTAGTATCCTCTCGACGTGATAGTAGAGAGTGACCTCATTACCAATCAGT
GGGGGCGGGGGACGCCACGGACGTGTCGACGAACCAGGATGCCCCGCGTCACTCGTCGGCATCGTACACCTCGGCGAATGACGTCTCGTCGGCTCGGGGG
AGCCTCCTGACTGCTGTAGAGGGCTGCCAGAGACTGCTGAAG