Description :
From Genome Similarity Track
Location :
Scaffold_2405:1011- 2679
Transcript NameFunction/comments
Phyag_g12440hypothetical protein PHYSODRAFT_522664

Sequence
1668 bases(100 bases per row)
AGCACGTGGTTCTGCATGATGTCTCTACAGACTCCAGACGGCACGTGTCTGatcgctggagaagatggagacatTGAAGTGAGCTCTAAGGGCAACGGAT
GCATGTGGCAGACGCTGTTGGGTGCAATGGGGGAAATTTTCCTCCGAAGTGCGCACGGCAAGTTCCTGTGTGTGGAAGAGGATGGCACGATTCTGGCCGA
CCGACGGCTAAATTCTACGTGGGAGACTTTCCAAGTTGTGCCTCATCATGAAGAGAGCACTGGGGCCACTGCTGGTGGGGTGGCACTACGTAGTTTCCAC
GGAAGTTATCTGTGCATCGACCCATTGGAGAATCGGGTCGAGGTGACAAACCATCCTGTGCCTTGGGACGGAGATGATATCATGTCGTTGGTCTGCAACA
AGGCAGACTCGCATCCGTTGTTCGTCAAGATCATGCGGAAGTATCAGACTGCTGCGTTCGTGAAGAACCAAGTGGACAAGTATGGAGACTTGCAACACGC
ACAGATGTCGATTCCCGATGCGTGCAAGTGCTTGATGGAGCTTACAGGCGACTTGGAGAGGGAGAATAGCTGGGTAGTCAAGTACATGCTGGCGACGGCT
GCTGCGGTGAAGGAGGATGGACACCCCGATtggctgcaacttgcagttTTCCTGCGGGCGCTCGGTCTGCTGTTCTTGTGTTGGACAGATGATGATAATG
CTGCGTTGCGTAGCATTTCAGCACAGGAGTGGATGGCCAAGAACTCGACGTGGGTTGTTGGAGAGCGCATTCCCAGCTCGATCGAGTTCCCAGAATTGAA
TGAGCTAAATCTAGACCACTGCAACGCTGAAAAGGAAGGCCGTACTGTCGATAGCCACTGTGGCTTGGAACAGGTTATGCTGCCTTGGACCCCGGACGAG
TATCTGCACTGTGTGCTGTCGCGTAATAAGACCACACTCCCAGCTGAGGCTCTGGATGCTATCCGCTTTTGGTCCTTCAAGACATGGTATGAACAGGACA
ATTACGACGACTTGTGCGCTCCTCAGGACGTGGACACCAAGGAGTGGATCAGTTCGCTCGGCAAGGTGGCTTGTGTGTCagaggacgtggtgcagaGGGC
CAGTGTTGAAGATGAGCTCCCGCACTACTTACAGCTGGCGGAGAAGTACCTACCTGACACACTGCAGTGGTGAAGAACTCTCTGGGGATTGATGTTGCGT
GTATTTGCACGTTGGTAACTGTATGAATATGAGATGACTTCATGTACGCTGTGACTGATTGATACCACCCGGAGCCTGGATATTCTCTTTGGACCGCCTG
GATATTTCCTACGGCCATGAAGTTGATGGCGGTTACGAATGGTGGTGAAAAATTGGTATCTGCATCTCCGACGAGACGTTATTTGGGTTATGCCTttcct
gctggaagatggCGATGATTTCGTGCTCGATGAATCCTTGgcgctcgatcttctcgcaGATTTTGATGAAGACAATGTTGACTCCGCAAATCTCTCTATC
GAATTGAATCAAAGTGAGCCATTAAGGGTACACGACAACCCGTCGTTGGAGACcttggcgatggaggagaagaaatcGTGGCGTCAACAGCGAAAAGAGG
AGACTCTGCACCTTCGTGAATTGGTACACCATCTTTCTGCCGAACTGGAGATTGCCGCCGAAGCGAAC