Description :
From Genome Similarity Track
Location :
Scaffold_80:101068- 103177
Transcript NameFunction/comments
Physo_139943hypothetical protein

Sequence
2109 bases(100 bases per row)
AGATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTC
GTGGGAGCCCGTTGAGCAGCTTCAGGCAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGG
CCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAAGTCGTCCATCTTCGAGTG
GAGCTTGCGCTTGCTCACGAGTTGAGCGAACTCGATGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCGATCCTCACGGAGTTCTTTGAACTCT
TGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGCAGAGGTCTTCCACCTCGCTCCAGGTCATGTTGTCATTCGGCTTGACCCGGTGGAAACCCCACA
CAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACATC
AACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGATCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTC
TCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGAGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAG
TCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCTG
CTCGTCCTCACGCTCCGGGTCGATGAACAGCTTGGAGCTGGAGCCGCAAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCA
GCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTGGATGCCAGCACCGCCTTGGCTTGGACCCCGCGTCGCTCGG
CCACTTCTCGGCCACGACCCCAGGGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCCGCCTCCTTCTCT
GACGAGGCCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGT
CGGGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGACGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTT
GCCTTGCGCGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCCGCTGCCTTCGTA
GCCTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTATGGCCCGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGC
GCTTTGGAGGCATGCTTCCAGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCG
CGCCGTTGTCAATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGCCGGTGTAACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGAT
GTAACGGAGTTACATGGAATAGTCACCCTGTCACTATTCCGGGATGGCTACATCGGTCACTCCCCTGGATAGTGACCCAATTGGCCTCAGAGCCAACAGA
TACATTTTGTATGACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTT
CAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCG
TCACATCTA