Description :
From Genome Similarity Track
Location :
Scaffold_11:101046- 102349
Transcript NameFunction/comments
Aphin_H310_14662Hypothetical protein

Sequence
1303 bases(100 bases per row)
GCATCGGCGATGAACGAGGCTGTTCATGGATCGCTCGCTCACCCTTGATCGGGCTCGACAGCCTTCTTGGATATTTCCGATCAGACACAGGCTCCATGTC
CCACCAAGGGTCTCTGTCACCCTGCACAGTGGCTACCACATCCCATCCATTGTCGCTATCAACTGACAAATGTTGGGCGTCTTCTCGTCCAAGTGACCAA
TGCGACACTCGACGTGTACTTTAATCAACATCACGAGAGCGTGTGGAAGTGGTCAACGTCGTTCGTGGTTGGATCCATGTGCATTACTGGGTGGATGGAA
AAATTTTCGTCGCACGATCCCCCAACGTGCGAACGGCACATCCAAAAATCCAACGTCTTGGCGACACTTCCGCTCGTCCGAAGGAGCAGCACAAAGTCCT
GCAACGCCAACGAAGGATTGTACGAACCACGGTTGCAGTGCTGGGATTTTTTATACGCTACAGATGCGAACTTGAATGTGCCGATGCAATTCCAGTTGAT
GGCTGGGAATGTGGCATCCAAATCGATGGCTAGCCACGACAATGGTGTTGTGCAGGACATCACGAAGATTGCATCCACGTTGGCCACTCCATCATCATCA
TCTCGTCACACGATGCTGCTTCGTTATGCCCGAACGATGAGGATACGAATTCTCCCATATCCTGTCCGGCGACAGTGGATTTTCTCGCATCAATCAAAAT
GGAAGTTGAGATTTTGGCTCTCGCGCACATGGTCGCTGTCGCAAATGTGTCGCTGCTTCGATTGAGTTTGGATCCGTCCCCGCGACCACAGCACTCCTTA
TGACCACGGGACGTCTCGATAATTTCGTCCTCGCTGCCCCGTTGATGCTGCAATTCAACCAGATTGTTCATGTTTCACGTAGTGTGCACCCCCGTCTTGG
TTGAATGGTGTGTTCCACGACAGAAGGCATGCCTGACCGCCTCGGTCTCCTGAACACAGAAGTAGAATTGGGCATTCTGTGGGCGCTTGGGCATATTCTT
CATGTGACTGGAAGGTCCTTGTGCGCTACATAACTGCTGGACGAGCTCCGTTGGTGAAGCCAGGCGAGACATGCCTGGGTCACGACCACCAGCGGTTTGG
TCAAGCACAGGATGAAGATGGCATCGTGGTGGTTAGGTGAGCTGCATACTCGTTGAGTGAGGTGGCATCATGCACAGCACACGCAGGGAAGGAATGTGCG
AGGGATTTCAACATAATGAGATTTATATTCATTACATCATGGATGCCGTGGCGGCCACGACGAGAGCACCCGTGGAAACGATGGTGACGATGCCATTGCT
GGT