Description :
From Genome Similarity Track
Location :
Scaffold_513:10104- 11573
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_513-snap-gene-0.3Dynein heavy chain

Sequence
1469 bases(100 bases per row)
CGTCGAGAACCACACCATGCCGCATCGACTCACGGTTGCAAGTGTAGCGTAACGGAGAGTTTCTGTCTCCATCATGATCCAGACGTTCGGTGGAATCTCG
AGGCGCTCTCCCGATGGAAGGGTGAGCAAGCGGTTGTCGTCGAGAACCGAGTTCAGGTTCTCTGCCCACTCCGGATCGACGTCGCCATCAAAGATGATCC
AGTGACGCTTTTCACTTTCGCCGCGGACGCTGTTCAGCACTTGGCGCAAGATGTTGGTGAAGACACCGTCAGTCCACTCTAAAGTGGTGTTGTCGAGCAC
TCCGTACAGGTGCTCCTTCGAGAGCGCCTTTGGATCAATCACATGCGCTTCGCCCTTCTTCCCGTCGAAGAGCTCTAGTGCATCCAACAGCACACGCCAA
GCTGCCGATTTACCGGTTCCGGAAGGTCCGACAAGCATCACACCGTGACGAAGCTGCATGACTTGGTACAGCTGCAGAGCCTTCTCAACCCACTGTTCGT
GCGCAACGTAGTTCTTTTGCTGCGCTAGCTCGACAATCTTGGAGCGAAGACCATCTTCTTGGATACGGTGGGTGTCGGTTCCTGGAAAGACTCCCTTGAG
AAGAGTCTCAAACACTGGCACATCGTGAGCAACGAGCTTGGGCATGATAGTGTCACTGATCGATCCGATCAACGCCTTCGTTTCCAGCTCTTCCATGGTC
GTGTCGGCCGAAACCTTTTGCGAGATTTTTCGCTTCAGCTGCCCGGCGCTGACCAGCACACTCTTCAGCGCACGGAGCCCGAAGTCGTAGTGAGGTTGCT
TGGACAACTGGTCCTCACAAAGGTTGAACAGCAGCACCACCTTGGCCGAAATCTGCTCCGCTGTCGTGATGCCTTGCGAGAAAAGCATCACCTGCGCGAT
CAACTCGCGATCTGGGGCCACCATGGCAATGCTGCGGAACAGCTGTTTCAGGTTGTCTGGCAAGTTTGATCGACCAGCGTAGCCTGGGTTCATCGTCACA
AAAATGCCGACATCCGGGTGCAGCTTTACACTCTTGCCGAGGAGCTCGATGGTCGTGCCGCTGTTGTTACTCGCAACAGTAAGAGCTGAGCCATCAGGCT
TCTGGGTCTTGATCGACGAAACGCCGCTCTGGATTGCCAAAATCTGCTGAGAGACAGCCGAGAGCACGCGCTCTTCGAGACGGTTGAACTCATCGAAGCA
GCCCCACGCACCAACCTGGCAAAGCCCAACGAAAATGCGGCCCATCGCCTGAAAATCGAAGTGCTCGTCACAGTTGAACACCAACACGAAGCGTCCAAGC
TGCGAGCCTAGTGCTTTCACGGACTCCGTCTTACCAGTACCAGCAGGACCGAACGGGTTACCACCCATACCGAAGTCTAGCGCTTGAGTCAGTGTCAAGT
AGCATCGCTCTGTCAGCGGAGTAGACACGAGTCGCTCACCAACACCAAGATACTCGAATCCGTAGGAGA