Description :
From Genome Similarity Track
Location :
scaffold_243:10103- 17177
Transcript NameFunction/comments
Pl_107137hypothetical protein PITG_00210
Pl_107138hypothetical protein PHYSODRAFT_302452
Pl_107139hypothetical protein PHYSODRAFT_560629

Sequence
7074 bases(100 bases per row)
CCAAGTGATGAATCAGAAACGGAATCCAAACAAGGTGGCAAACTTATCTACAGTAATTTGCATGGATATCGCATTAATGTTGATGAAGCCGACGATGCGA
TGGAGTACGAGAGAATTTTGAGCGAGTTACGCGGTACGGAAAACGCTCGAGTTCGACAAAATCAACTTGTCGAAAAAATGAAGATGAAACAAGCAGTACT
TGCGGCAACGAAATTTGAAGTTGAGGACCAGCGTGCAAATTACGTTTCGATTGACAAAGATGACCACATTGTAGGATGGCTCGTGCGTGAGGAGGTTCAA
ACACAATTACAATGGGCACCGCTGCGCTCTAACAACCCGCTTCACCAAGACCTTATTGAGCAGCAACCAGATCGTGCCACACTAACTGAAGAAATTCAGC
CATTTTTGTTCTCTGTTCCGATGGCACAAAAATGGCGGGTTGTCGCCGGACTTCTGCATATCTGTGGTGTCAAATGGCGTGGCGAGTTTTCATGGAAGAC
CAGCATCCCCGGTTTTGAGGCTATGTATGCAGACAGCTTTACCGACTACGGGATACTTGTGGCTCCGATTTTATGTGCCCTCAACTCGCAGATCGGTCGC
GGTGGGAAGGCCACACTGTTATTAAATCCGTGTGACCGAAAGGAACTACTGGAGAATGCCCTTCTTGGTGATGTTGCAGTAAAGGATGGTGTACTCCGCG
ACCCTAACAAGGTGGGATTTATCCGTAGAGTATTCCAGCAGTCTTTGAATGCCTTCCGCAGCGACGAGAGCTTTGAAAGTGCACTCAAATGTGTGTGGGT
TGGTTTTGAAGCTCATGTTACACGCATAGCTGATGGTCAAGAAGAAAGTCAATTGTATGCCCGACGGTTGAGTCAAAAGTTGGCTCAGGAGACTATGAAT
GGCGGCACCGATTTTGACGTTCTGTATGCCTACGCCAAGCTGGAGCTTGTCTTGCGAAACGAGCGCCAAGTACGTCGTATCTGCGAGAATACGCTGAAGT
CACTCACTACTTCCTCCCAAAACAACACACTGGTAGCTAGACATTTCCATCGCTTTGTCTTCCTTCGCGCGCGACTAGAGATGTGGCCTAACACTGGTGA
TGCAAAGCAAACTCGCGACTCAGGACGACTTCGTTTGTTGTGCTGTTTGTACACTTTGTGGAATCGGTGGCAACCCGAACAACTAGACAGGAAGGAAAAA
GAAACGCTGAATGTGATTTCGAAAAGGCATAAGAAGAAGACTTACGCCTACTTGCAAGGGATCTTAATGTCCGATTCATCAACTGGAAGGGATCTTATAG
CTATATATCGCAAGGAGCTCGATTTTGCGATTCGGTGTTGTGTTGAATCTACTTCGCAAGATGCCGAACACTGCAACGCACGTAGTAGACCGCACTGTCG
ACCGAAGTGCTGGGCTGGTTACTGTTTGCACAACTTGGCACTTGTCGTTTACGCCTACCACGGATTTGAAGCAGCTTGCCATGAATATAGACAAGCGCTT
TGCCATGTGGAGCATCGGACCTGCTCGCAGATAGCATGGATGTGGACTTGCTTTCTGGAGTTCATGCAGCAGCATCAAGTGTCAGGTTTCTTCCCCGTAG
TTGCTCCTCGGTTGTGGCGCTCGTCGATTGGTGAGGCGGTGGAAAACTTTCCGAACAACGAGTTGTTTCTTCGACTCTTTGTCGATTCTGAGACAGGAAA
CACTATTTCACAAGTCCTTCGCAACTACTTCCTTCGGGTAGAGAAGCGCTGGCGACGACACTATGATTCACCACAATTGGCGGAGTGGTTATTTGCATTA
CTGTGTGAATTTTCCCGCGCTGAGCGAGCTGCTACAATTAAAGTATTATCAGAAGTTGCACAGTCGAGCAGTAACAAGCCTTCTTGCCCTACGTGTTGTC
TATTTCATCGCTGGGGAATGAATACGGCCGCAGTTAACCGTCTCCGGCAACTGTTTGAAAGCATGGTGAATCAAATTCGAACAAAAGGCAACGTACTTTG
TTGGAGATTATACATGCGCTTTGAGATTGCTCTAGGGAAGGTAAATTCGGCGAAGAAGGTGTTATATCGTGGAATTGCAGCCTGTGCGTGGAGCAAGGAA
CTATACATGGATGGGTTACGTGTGATGCGTGCATATTTGAGTGAAGATGAATGTCAAGAACTTCTCGAATTTATGGAGGCGAAGGAGCTGAACGTGCGAG
TTGATTTTGAGTGAATAACAACCAAAATTAGCCTGAAAACCGAGGCGACATAATTGATTGATGCACGAATGAGAAGTGGGTGTTGCAGCTAATGGTGAAG
ATAGCAGGAAGCGTGAAGGAGCAGGTATGATAACATTTGCGTGGATGACATGCTTGTCGCACAAGGGTTTGCTGACGTATACACTATGCTTTAGCCTTTG
CAACGCCTAGATGCTCTTAATGGGACAAAGTGGAGTGTGGCAAGCATCTTAAATGAGATCATACCTGAGCAAAGGAATCTTTGTGATGCAAGACAGTTGT
TGCTGCCTGATAGAAAAGCTATTGACATCAGAAAGCGTAAAGCAACGGGTGATGCCACAAACAAGCGCAGCAGATCTGTGCTACCACTACGAGCAACCTA
CGTTCCTCTTCATTCTTCGGTGGGACTCGTAGAGACACCCACTAAACACCCTCTCGTGATGTCTTCCGAAAGACACTCGCCATCAAGTAGCTTTCGAAAG
CATGTGCTTTTGCTCTGGGAGGACAAGTTTCGTTCGAAATCTATAGAAGCGAAAGACGTTATTTTCTTGCTTACACATCCAAATGTGGCTAACACATTGG
AAAATGTGAGCTTTCTGCGAGAATTGAATCTGACTTATGATCAAGTCATGGAGTTGGAGATGACTCTTGTTATGCTCCGTCGTCAAGAAGAGTGGACTAA
TGCTCGTTTTCACAGAATACCGTCCGTGTCGCTTTGTGACAAACTTGCTCGGAATGCATGGATGCATGGTCGGGCACTTCCCGGTGCCCATCCCAGCTGC
GCGGTGCTCCCAGAGGTGATCTTACCTAGGCGAGTGCCATCTTGCAGCATAACTCGAGCAAAAATTCAAAAACAAACAAGGATCCCGATCAAAACGAGTT
CTGCTCTCACTTCGTCGATTACTCCAAAGCTGGAAACCTGTCCACTCGAAATTCGTGAATGGGTGCGTGATAATTGTTTGGAAGAGGTTACACGCTCCGT
GACTATGCGAAAGCAATTTGGGGCTGAAAAGCTAGGGGTACGAACGGTAGCAAGTGGGGTCTTTATCAACGACTCACTTATTATTTTCTACAGATCATTG
TTTCACGACATTTCCACCAAGCCAAGAGCCGACGGTTTTCTCATTGGCACCAGCAAACGATGTGGATGCAATGCCAACAGCAGATCCGCAGGTTTTGTCG
CCTGTGAGTTGACAGTTTACACATAGATTATCAAGATTTACTTAACTTGGTGTGTTTGAGAATAGGAAGTGCGCGTTATGGGTTCTCCAGAACTCGCGCA
AAAGACTAAGGGGTGCAGTATTTCGATTATGGGGCCGCTGGATGGTAAACTTGGCTTGCCAACGTGAAAACGAAGTCATTGCTGCTACAATTACCATTCA
AAGTTGGATACGTGGGGTGAAAGGGAAACGAGCAGCGGCTTCCCATCACCTGCATCTAGCCGCCACTCTAATCCAAACCCGTTGGCGAGGAACACATGCA
AGAAGGATGCTCAAGCGCAAAAAACGATTCGTAGCGTATAATGTGGCTGCCCACCGAGTCCAGCGATTTTACCACTCGTATCGTTTTCGAATGAGGTGTG
AAGTTTGGATGACACAGCAACATGCATCCCGTGTAATTACGCGCTCTATCGCTCAGTACATCGAGAAGAAGCGTGATATTATTGCTTGGCGTCATCACCT
AGCAAGGTACCATGCAGCGATCTCTATTCAGGTTTGGATGCGACGTACAAGAAGGCGGATTGCAAATGTTAAGTCGACGCTTGATAAACGAGCGAAAGCA
AAGCGGGTGCTGTTTAACTTTTTCCGGTACATTTGGTTCATTCACTATTTCGGTTCACGCGTAGAAAATTCTGTGAGGAGGAGAACGGCTGCTGCTGTGT
TGCTACAAAATGCGTATCGAGCTAAGCAGGCACGAGCCCGGTTCTACGAATTGAAGGTTCGCCTGGAGGATCAGAGACGACAGGAAATTTTAGCGCTCAT
GTGGAATAATGCCTATGCCACGACCATCCAAAAGTGGTGGCGGAAGCGTCGTCATCGACAACAACATCTCATGTCCTCTATCAAGCGACGAAGAGCTCAA
CTTCCGAATGATGAACAAGTCGAGCAGCTAGTTCATTCGACATGTAGCTATAATCAAGTTGAAGTGAATTCGTACTTATGTGAATTTCTCAGACAAATCT
GAGTCAGCTTTGTATCCACATCTTCCCCTCCAGAACGTGAGCAGCCATGGAGAAGAGTGAGCTCCGTGTGCGCTGGCTGGTGCTGTTCCTGTCGTGCGTG
TTAATGATCGGCAATTACTACTGCTTCGACAACCCAGCGGCACTCAAGAGTCAGTTGCAGCAGCACTTCAGTAATATCCCCAAGGACCGCTACGAGTTTC
TCTTCGTAGGTTTACGTCTTATTTATTGTTATTGTTATATCAGTATCAAAATATTCCCGGAATGAGTTGCAATTAACGGATAATAATTGTTATTGCATGT
TTTTAATGTAGAATCTGCTGTACACATTGTACTCGATCCCCAACATCTTGCTACCATTCTTTGGTGGCGTGTTGGTGGATCGATTCGGTGCGCGTGTGAT
GCTGTTCGCTTTTTCGACGGCGATTCTGGCGGGACAGTTGATCTTTGCAACGGGCTGCTCGCTCTCGAGCTTCAACATGATGCTGGTGAGACAAAATTTG
CTGGGTCCATTGATGTTAAACGAGAGAATGACGTTTCTTTTTCGATGTATTAGTTTGGTCGAGTGGTATTCGGTTTCGGTGGTGAAAGCTTGGGTGTGGC
TCAGGGAACGCTCGTCGCCTCGTGGTTTAAGAACAGCGAACTTGCTCTCGCATTGGGCATCAACCTTAGCGTTGCGAGACTGGGAAGCGTCATAAACAAT
GAGCTGAGTCCGGTGGTCGCCCAAGCGTCAAGCGTGTCGACGGCGCTGTGGGTGGGTGTTATCATGTGTCTAGCGTCCACTTTCATGGTGTTGCTGGTGA
TTCCCATCGACAAAAGAGCAGAGAAACTGACGAAAGAGAATCTGAAAGAGGTAGGGGCGGCTGCTGAGAGCATTCATTTTAGTGATATCAAGCATTTTCG
ACCAGCATTTTGGCTATTGGCGCTGAGCTGTTTGGTGGTCTACGGTTGTGTCATCCCCTTCAACAACGTTGCCAGCAGTCTTCTTATGGAGCGCGACTTT
TTCAAGGAGCCTCCCGAGCCATGCCGAAGATGCGGAGAGGGACTATATGATACTGTAATCGATTGTCAGTACATTGTTCCGGGGTGTCCTAGTGCCCCTC
CCTACGGATGGCCACTCCCCCTTCTGTCGGCGAATTGCACGATCAAGGAACCACAGGACCAGTGGAATTGTTCGACTTCACCTCCACTGATTCTTGGCGA
CAAGATTAATTGTGACGATGAAGCGTGGCAGTTTGGGCCGCTGACAAGGACGTACTGTGCCACGAAAACGGACGCAGCTCAGAAGGCTGCGACGCCAATG
TCGATCCCGTATATTATCAGCGCCGTCATTTCGCCATTCCTCGGGTTCGTGGTTGACCGTATCGGCCTCCGCGCCTTTTTGGCGTTGGTGGCACCCCTCG
CTCTGACTGCAGTCCACGTCATGCTTGGGTTAACTCAAGTAACACTCTACGTGCCGCTAGTACTGCAAGGTGTCGCCTACAGTGTGTTTGCAGCAGCACT
GTGGCCTTCCGTGCCATGTAAGTGGCCACGTGCTGATGAAAGCCTCATATGAGCTTCAGGACTCTAATGATATCCCTTGGACTATGTAGATGTGGTCGAG
GCAAAGCACGTTGGAACTGCATACGGAGCGATCACTGCTATCCAGGTACGCACCCAGTTCGCTAGTACCGCTCCAGAAGAGCATTGTTGCTCACAGATAC
TACTTGATTCTAAACGTTTGTTGCGCGCATATCTTCCAGAACATCGGGCTCGCACTGTTCCCGCTAGCGGTGGCAGCTGAATTCAACCACGACGACCGAT
ACATTCCGGGGGTGGAGCTGCTGTTCGTGTCATTTGGTGTGCTAGGCAGCCTCGTGGGTATCGCCCTCAATGTGGTAGACTACCAGAACGGGTCTATCCT
GAACCACACGAATGCCAAGAAGAGACGGGTGTCGCTCATGCTTGACGAGGACGCACTTGATCATGAAGCGCTCCTGGCCGCCGAGCATTAATTGCATGAG
CAACATTCAAGGTGTGTAGCCATTTCGGCTCACTTTGATCTTCAACCAGCGAACCGAAAGACAAGCAAAGGATTATCGACTTCAAATCGACATATGTGTA
CGTGCTCAGAGCATGAAGCAGCGATTGTCTGCAGCAACAACAACAACCTGAAATGCACGATCTCGACTTTCTCTTCCGCCTTGGTTGTGTTGGCTCTGTA
CGATAACGATGCTGGCTTTTTGAACTGACTTGCCTATACCGAGAAATGAATCCCGGAAGTCAAACCAAACCGTCACGCAGTACAGTGCCAGTGTGGCGTT
GTAAACTCACTGAAACGACAGGAAACGTTAGATCAATCGTAATGGCACCACTTCGACGTGTTCCACTTGCGTTTTCCACCAAGAGATATCGGCGGTCAGT
GCACGCACCCATCACTTTGGTGCTATGACATACTTAAGTACATGCCTGAATATTTCTCTAGGCAAATGAGGGATAGGCCTTTGCCTCGGTAATTAGCCAC
ATTTCCTCGCTTCGATTTGACATTTGATTTCAGTATAGCGCGTGGAAAAGGGGAGCAATTTTGACTTCATGGGAGTCAGAAAAGGGGGAGAGTTGGCTGG
CGTTTGCCGTGGCGATAAGTTGCTCCACAAACCGAAGAACAGCGGAGAGGAGAGAAGTCCCGCGACTGATCAGT