Description :
From Genome Similarity Track
Location :
Scaffold_32:1010027- 1017924
Sequence
7897 bases(100 bases per row)
CAGGCATCTTTGGGATGGAGGCCCTGCAGAGCCTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCT
CATCGCGCATGTGCGGGAGAACCTGCAGGCTCCGGCGGCGGGAGCAAACCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAG
GAAGGCGAGAACCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCA
ACCTTAGCGGTCGTGCTAAGAGTTGGGTGTACACTCGGGAAGCGACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGC
GTTCCTCCCGGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGACGCGAACTGCACGAGTATGTGCAAGAGATACGGGAG
CTCACGGCGTCCCTAGTGGGAAACCCACTCAATGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCC
GGGTGCAGGCAAGCACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAATACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAG
TTCCTTGTCGGCTCCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAG
ATGGGCCACTTCAAGCGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGG
GACAGGGGAACGCAGAGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTGCCACGAAGACTTA
GCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTATGGGATACGATCATCCCTTTAGAATCTT
GATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGCTGCTCGTAGCAGCAACCAGTTGTCTGATGCTTTGAGAGAAAGCAAGGGCAACGGA
ACGGTGTCAGTGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTCGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATAT
GATCCTGGGTATGCTCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTG
GTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGAAGTCGACGTATATGACG
ACTCCGAGGATGTTTTGATGGTGGCCTCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTTCGCAGGCAGCTGC
AGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTGAAGAGGAAGACGTCGGATACGCT
TCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTAACACAGTGCCACACG
CGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGC
AACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGACAAAGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATC
GACGTCGCCTCAAGCGACTCGGCGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAATGTTATCACTTCTTCGATGGCGAGACAGGTTTACCCG
TCAAGGCATCTGGTGTCCATTTAAAACCGCTGTTAGAGGTTGCAGAGATACTGAACCTCGAGGAGATGACGGCTGAGTCTTTCCTGGCCAACTTCAAGGC
TGGAGAGATTGCTGGGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAAC
AAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACC
CACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGA
ACAGTGCGAGGTCATTGATGCTATCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAATCGAAATCCCCGCACTCGACGCCGACTTTCTACGTTCGT
AAGCCGAACAGAAAGTGGCGTCGGGCTCACGCTTATAATAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGTTGTTGA
ATAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGAGAGAGAGCGACATCCCGCTCACCGCGGTAAG
CACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCT
TTGCGTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGCCGAGGGAGACAAGACGGCCATGGAGGTGCATCTAGGACATCTCCGTC
GAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTCCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAA
CGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAAC
TACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAACAAGAGCACCAGG
ATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTA
CGCCATCGGGTGTGCATTGCTGCAGGACGACACGGCTGGACAAGAGCGAGTCATCTCGTTCCAGTCCCGGCAGCTCAAAGCCGCCGAGCGGAACTACCCT
GTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGCTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGT
CCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTTGCGGAATACAACTTCCGCGTCGAATACAAGCCGGG
CAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCTGACTATGAGTTGGCCCACATCACGCGGGCGACAACGGATCTATATGATCGGATACGCATG
GCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGAAACGAGCGCGAAGTCCGACTGGATCTCGTCGCGACAGCGCTCACGGC
TCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTACCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGA
CATCCTGGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCACTCAGTCCTTCTGGTGGACCCACATGTAC
AAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTG
ATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGAT
GGTACATCTTGCTCCAGTTCCCGTCACTGTGACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATT
GTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGA
CCGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGT
TGAGTTTGCGCTCAACAACGCGGTGCACGCGTTCACGGGTTTCACGCCGTTCTTCTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGA
GACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAGGTGGAAT
CCTTTATGGATACCAAGCTGAACATAGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAGG
AAACTTAAGTATATTTGAGGTTGGTGACTTAGTGTTGCTAGACACGAGGAACCTATCTCTAGACACTGTTAGCTCTGTCGGCAGCAACAAACTGAAGCAC
CGCTTCATCGGGCCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGAC
GTCTTAAGCGGTACTTTGACCCGCAGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGTGGGCG
TCGGAGAAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGTTCCATACGAACGGACCCCGGCGCCATACGCCGA
GTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATG
CGAAAGGTCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTTCAGGCGGCCCGCAAGAC
GAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTC
AACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCC
CCTGCTTGACCGAAATGGAGAAGTCCACTTCCACGTGAAGCGGATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGT
TATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATA
AGTAGTCCGGGGCTTCTTGCTTGAACGGGGTACGGTCGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCACTTCAGGATGTCC
CTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCGTA
CCTCCGTGGGTGAGTACTTGAGAGTCTCCACCCACGACCAGAACATGTCCTCACAAGAACTCCACGTGGGACAGATCTCGGGCATAACCCAGGGGTACCC
CCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTTAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCA
GCCTCCAAGTTGTCGACGAACAACTGCTCTTTCTGAACAAGGGCTCGTGCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGA
AAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCAAGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACC
CCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGCTCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCTCCTCTTCCTCTTCT
TCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCGAAGATACTCCGATAGGAGCGACGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCAGTACGCT
TCTTTGAGGGCTTGGCGCCTTCGGCTTTGGAGGCCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCCCTTCCTCATCGCCACC
GGCTTTGGGAGCGTCCTTAGCCTTGACGGCCGGACTCTCAGAGCGCACAGAGGTCCTAGGACTGTGATCGCCTTGATCACTAGCGGGCGATTGCACGCTG
TCATCTTTGTGTTCACTGGGCACTGGGTTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCCCAGACTCGGCATCGTCCTCACTGTCCGAGT
TGAACTCACGTTCTACGAACGAGGGCTCGGACGATTGTCTGAAGATGAGGGCGACGGGCTGCGACGCTTGCTTGCGCGCTTGTCCACATCCGCGTCACCC
GAGGAACCGATCGCCTCGGAGGCCACCTGAGCAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAG
CCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTCGAAGTGGAGACCTAGACGAAGAGCACACAGGTTGCTGCTCGAGG
CTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCACGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAGCACCTCTTCATTCTAAG
TGGGGGAGGATGAAACGGGGTACGTAGCCCTAAGTATACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACACGTCATACTCCGAGAT
ATGTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTAACAGTTTGTATTAAACCCAAACTTAAC
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTAAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACAGTTTAATTGACCAAAAAAATGGTCAGATCAAACAATTCGGT