Description :
From Genome Similarity Track
Location :
Scaffold_3708:1010- 2201
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3708-fgenesh-gene-0.0Poly [ADP-ribose] polymerase

Sequence
1191 bases(100 bases per row)
CTCGCTCACTCGCCAATTCATTCCCCACGCTCTAAGAGTCCCGCCATGGCCCCGCAGCCCAACGACGCCAAGGCCGCCGCCGCCAAGACCGACGCCACGG
CGCCCGCCGCCGGTCCCATCAAGAACGCCTTCAACCAGCACACGGAGCACGAGATCTTCGAGCACCCGGAGCTCCACTGCGTCTTTCCGAAGGCCACTTC
TCCGCCCATTCCCGAGCTGCCCTACGACGACCGCGCCAAGTATGCCGACCCGACTCTCAAGAACTTGCTGGCGAATGCGACGGTGGAGCACCTCGCGCCC
AAGATCGGCACGCAGCTCACGGGCATTCAGCTCCATGAACTCACGGACGCGCAAAAGGACGAGCTCGCGCTGCTGATCGCGCAGCGTGGCGTCGTCTTCT
TGGTGGACCAGGAGATCACCCTGGAGCAGCAGATCGCACTGGGCCGCTACTGGGGGCCGCTCCACGTCCACCAGAACCTGGGCCACCCGGAGGGCAAGCC
CGAGGTCGTCGTGGTCGAGACTTCGGTCGAAGCCAGCGCGGCGCTGATGGAGCGCCAGAAGCTGGATCCTACTAACGAATGGCACAGCGACGTGTCGTGC
GAACGCCAGCCGCCGTCCTACACGAGCTTCAAGCTGCTCACCAAGCCCCCTGTGGGCGGCGACACGCTCTGGGCGTCAGGGTACGAAGCGTACGATCGCC
TCTCGGAGCCCATGAAGAAGTTCGTCGAAGGTCTCACGGCCATCCACAGCAGCAAGGTACGGAACTCTCTCCTTTCTACTCCAATTATAAGTGGCTCGTT
AACTGACCCGATTATAACTCATGAACACAGGAACAAGCAGAAGAGGCTGCGGCGCGTGGCTTCACGATCCGCCGCCCGTGGGTCGAGTTCCGCCACCCAG
TCGTGCGCACGCACCCAGTGACCAAGCGCAAGGCGCTGTACGTGAACCAGGCGTTCACGCGGCGCATCGTCGAGCTCTCGCGCGCCGAGTCGGACGCCGT
GCTACGCATGCTCTACAAGCACGTGAACGAAGGCCACGAGTTCCAAGTGCGGTACCGCTGGTCCAAGAACGCCGTCGCGATCTGGGACAACCGCGTGACG
TTCCACTACGCCACGTTTGACTTTCTGCCGGGCAATCGCCAGGCCACGCGCGTCACGCCGCACGGCGAGATCCCGTACCTCGAGAAAGACG