Description :
From Genome Similarity Track
Location :
Scaffold_1488:101- 4365
Sequence
4264 bases(100 bases per row)
aacccctattacatagtatgacttttaggaggtaacttcactacaaataagcaaacaaaatacggttctcaatttcacctaaagtgttaattattatctt
aAATCTAGTCTTAATTAAAATTGTgggacgcaagtataataaagctaagtctaagaaacctacgctgCCTCATACACGTtcgcacacgtgtaagctaaAG
TagtgggctaagtaggcccattacactGCTTCCTGTGCATTTCTAGCGAGAATGGCTACACAACCTCAACTACCGTGACGTGACGACGCGTCAATCGTAA
AAAGATGCACCAACAATCAAGTTGCATGTTGGGCTGCCACACCACATCCCACCTTTCAAAAGCAAGTAAGTTATATCACACAACATGCACCTtaactgct
tcagcaacttaATCATTATTATCCAACCTGGTCATCAATGTGAACGTGGGCGTCCTGGGCCACGTCGACAACGGCAAGACGAGCCTCGTGCACGCCTTGA
GCACGCAGCCGCCCACCGCAGCATTAGCCAAACGCCCACAGATGCAAAAGCGCGGCATCACGCTGGGCTTGGGCTTCTCCAGTTTCCGTCTGGAACCATC
TGAGGAACCATCAGTCCAAGTCACGCTAGTCGCCTGTCCGGGTCATGCGTTCCTTTTCCGAACGATTTTGGGTGATGTAGCCATTATATTATAAGCTTAG
ACACCGTTTTGCTAACAAGTTAGTCGTGGGATTTCGCAAAGGTTGGTGGTTGCACTCCCCGATTTATGGTGAGACTCTGATTTACGATCTCTGTTTACTC
TCCGATTTAGTTCTTACGATATGGTGGAATACCATGAAGttgccgacagtacttaagcggagtttatacagaggttaagtcaaatggtgcaaatctgNCC
CAACATGGCCTTactatcaagcgaggcgaagcgtgcgagccgtagcgggcttagggttctgtcaccagcgagcgcagcgagcctttagggtaggtgggat
aaCACGGAGCGCggagcagggtgatagtttaaagttgacacccctcctttttgcatgtttatgtctgtcggcagcgtcggcagatgtcggcacctttatg
gtaaGGAAACATTAGATTTTGAAAGGGATTAGGCTTAGTTTTAAATATTGACCGTGTCCCGATCCGAAAACGGCTGGATCGGCCTAAATATAGCTCGTTC
ATCCATATATAGACAGGACACAATTAATCCAGTCTTTTGCTTAGACCTgaattttgaatccagctGTTAAGAGGCTCTCAAGCTGGATCACATTTTGTTT
TGGCCGTTTCAGATTGAAATCGTTTAGCTGTATTTAGCCTTAACCAGCTGCATTGACcgcaagtcgaacacggcctcCTGGGgccaaaacaaaataaaTA
GAAAAATCATTGTCCCTATACTGGAAAAATCAGACCGAGTGCGACAACGGAACTTCGCGAATTAAGCTTGGAAACGGTATTCATCAACGATCCTCGTCAA
GAACGAAGTTGCCGAAAAACATGCTCACTTATTTATTAAGATCTTCTCCGCGTGTGTTCAGGAACCAAGTGTGCTTGGGTGTTGTCTCCAAGTACTTGCA
GTTGTGGACGCCACGTGCTCTTAGCACGGGAAGAGCACGATATGTCACGGGAGTGCAGCACACCGGCGATGATTGACCTGACAAGCGACTGAAGAGCACG
GCGAGATGTGCTGCGAGCAGTCGGTGACGGAGATGTACGGGACGGTGGTGCAGGACTGATGGCACCGGATCGAGGAGGGaagcgttgaagttggcgaacA
GTCGGTGTTGACAcgactgcagaagatcgTGCCAGGAGGGCGGACACGGCAAGCAGATAAGCAACGGAGTATGGCGGTAGGGCGAGATGACATTGGATTC
AGGATGAGAGGACATGATAGGGGGAGTGCGGAAAAGAGGACCCTCTCCAAGCGGTTAGTTTAGGCAGTGGGTTCGTAGGAGAGTTCTGTGTGCGCGGCTG
GCCCACAACTCTCAGTTGCAATTTGGACAGGAGAAGTTCAGGTAAAGCGGCTAATTAACACGCGTGGGGTACTGCGGCAACGGGCCGGCCCTACCCAACA
TCAGAGAGATTTCACACGTTTCGTACTGCGACGACTGGTCGGCGACTCGTGGGGAGTAAAGCAAGGTAGGGCACGAGTGCATACTGAAAATGGTGCGAAG
ATGAGGTTCTAGTGCGTAGAGTGGCTGGGAACCGTGGTTAGCGGCCACGGGGACTCGAGGTACCCAAGTGGGCCTTGGCCGTATGAAGATGTGGCGCCTG
GAGCGCCTGTGCGCGTGATGAGGGTCCACATCCGAACTACATGTCGGTGCATATTTGGACATACGGGACGCGAGAACAGGCCCACAGACCTACCCGAGGT
TGCAAGCAGCCCAATGAACGTTCTCTCCCAAGCAGTCTCTATTGGATTGTAAACGGAACTCAATCCCCCGACTTAGTGTCGGCGACACTGTCCTCTAGTG
GTCAGCTCGTGTGGCCGCGACTTCCTCTACGTTGGAATTTAGATCGTGAGAATACGACACAGTCATTCAAAGGTGTTTCTTAACTTCCAGTGCAATATAG
CTCAAAGGATTTGGCGATGGACAAAGGCTCAGTGGCCCGCACACAGAGCCTATGTCCAACAGACCTCTGGAGTATAAACCTGTTGGCTCACTTTTGCCAG
ACGACAATCGAAGCTCTGCCAGAACGTGTATGTCGAAACTGCCCGAGGAAAGCTTATCTGGAAACACCAACGATGGACCCCCCAGTTCTTGAAGCGGGTC
GAGTTTGTTGTCATCGTTCATCACCGCCTTCACCGAACTTGGAAGCTTGTGCCGTTTGACAAGGTCGTACTCAATACTGTTTCTTTGGAAACACGAGTTG
CTGGGACCACCGCGAGCCACATACAAAGTAACTTTAATCTTTTGTCTTGGAAACGCCCAAATGGTTGCCTCTCGTCGGATGTACTCCATCAACGCGCTGG
TATTTTCATGTGGCTCAAAGTCGGCGCTGTCACTCCATCCAAGACCCACAATTATACAATGTGTGTTGATCATCGTTTTGGGAGCGGGTGTCTGGTCTCG
ATGTAGGCTGCGGAGAGCAAAATGAAAAATGCCAACAGTTCTACCCGAATTTCTTCGAAAATAGCAGCAAGACATCAATTAGAACTCCACACGAAGCACA
ACCTACATCGTGCAAGGTTCTGCAAGCCGTTGGTTGATTGATGCCCATCCAAGGTCCACGACTCGACTATTTAGTCGTATTTTGCTGTGAATTCTTTCGA
GAATAGCCTCGATACAGCAATCAAAATTTTGCGATAATTGCATCTGCTGAATCAGCTTCACTTGTCCGGATATGCTTATGTGGCGACAGTACACCAACGG
GCAGCAATCACTGCAGGCTACACAGATTATTTCATTGatgtgcatgtacatgtaccactACACGTAGAGATCTGCCCTAAGACGAGCACCTTTTTCCTCT
CAATAGTAAAAAAGTAATGTCCCGAAGTGCCTCGGCGGAGATTCTTTTCATCGATACGGTATAATAATTGATCTGACTCATCAATGCCTAGGTTACAAAA
AAAGTTGCGCTGGAATGAGTGTTGATTGTATGCCCCTCCCTCTACAACGGTGATACTCTGATTTATGATTTCTCTCCGATTCAGTTTTAATGGATTGATA
CACTAGTTCGAAAATAGGTTAGGTTTACGTTTCATTAGTatgttctctgaaatttgtTTCAGAGCTAAGTCAGGATGCGAGTCGAGGTCCTATTATCCAT
AAAAAGAACACCTGGTAATTTATGTGAGAACGAAAACACAAATTTATGGAGGGTACTTACTAAAAACCAGTAGTGAAGGTACCGTGGGATGTATCGAAAT
TAATACTCGGCAAAACTGATAGATTCCCTGCATGTCGCCTGTGTCGTCGCCCTCGCGCTTAAGTGCGTAAACTATTAGCCAATAGAAAGAGTGGATGTTC
CTCGATGGTGACAGTACCATGCCCGATTGAGTCACCTGGGACTCGTGACAATCATGGGGCGGTCGGTGATGCTGTCCTGGTACATGCTGCGGTTCTTCGA
CCACTCCGTGTTCGACAGCGTGCTGTTGATTTGGCTTTGTGAGAAAGTGCCGTGTCTTCCATGGTCTTGGGAATACCGGTGACTTCCTGCTGCACTTTGT
GTGTCTACTGGGCCAGTAgtggagcgattcccgtagGTTTTGAATTAGATCCTAGATGCCGTGA