Description :
From Genome Similarity Track
Location :
Scaffold_1147:101- 3195
Sequence
3094 bases(100 bases per row)
CCGTTAGCTTGTGGTCGGTAACTCAGCGTAGCTCTTGATCTCGACTGCATCATCTCGGAGAACTTTTGGAGCACTTCACTCATAAACCTTGGATCTCGGT
CGTGCCGTATCAGAGACGGAGCCCCGAACTGCCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGTGCTCCGGTGTCATTCATAGCCTTAGCGAT
AACGAACCCCGTGAAGTGGTCCTGGAACAGCAGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGAAGGGGAATCACGAAATCCATTGACACGACTTCGAAT
GGATGGTCTGACACCACATTTCCCGGCGAATAACCTCTCAACTGTGGCTTGCTCTTACTAGTATTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACGT
CGGCGTAAAGACCAATCCAGTAGTAGTCAGCTTTGACTCGGTGATACGTTCTGACGATGCCTTGATGCCCTCCTTCGATCGAGTTGTGGTAGTTATGAAG
TATTTCGTCGACCATGGTTGACGGAATCACCAATCTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCTAGTCGGCGGGCTTCATCTCGGCGGTATAACAGG
CCGTCTTCGTTGAGTACAAAGACTTCTGCGACTTTGCCGGCATTCTGAGCTCGATGGTGTGTAAGGTCCTCCAATTCACCTCTCAGGTACGCCTTCAGAT
CGGCCCACCTGAGTTCTTCATCTTGTGCCTTCGCGATTCGTCGTCTCCGCTCAGTCTGCACCGTCACTGGATCAATGTCGTTGGCATTCTGAGCTGTCTG
GGCTGACTCCATCTGCGACCCTGTTTCGACATTCGGGGTCGTGTGGTTAATCCGCCGAGTCGACGCCCTGCTGACTTGTTCGAATTCATCTCCACTGCTT
TCAAACGCGGATTCTCCAGGATTGGTAGACATGGCTTCATGATCCTGACTTCCTCCTCTTGCTCTAGCCGAGTCTTCATCCAGCTCGTCCTCAAAGTGAA
CTCGGCGTACTCGGCTACGAGTGACTGCCGTGACAATCGGTGTTTCCGCTGGGTTGTCTGTGGCGTACAGTTCTTCGGCTACGCGGTTAATCATTCTCAG
CTCTGCTTTCCTATCCGTCCCAAGAATTACTCGTCCGGCTTTAGCTTCCAGTGCTTCTGTAGCGAGAGAATCAGCCGCTGCGTTATAGTGTCGCGCTATG
TGTCGATACCGGACCGAGTTGAGTTGTTTCGTGAGATCCTTGTGCCGGGCTAGTTCCACTTGCAACGTGTCCTTCTTGCATGCTATCACCCCCATGGATT
GCTGGATTGCAAGCCGGGAGTCACCCACGATAATCAGATCGGTTATCCCTCGGTCAATCGCCGCCAAGACTCCATTGTTCATGCCGGTGTACTCGGCGAT
GTTGACTGTGGTGGACGACAGGTACGCACTCGCAGCAATCTCAATGTCCCAATTCGGAAGGCGCCACAGTATCCACGAACAACTGCCATACCCGCCGTAC
TTAGTTGTCTTCGCTGAGCCATCAAATGACAGCACGCATCCTGCAAAGTCAGCTGGTATTCGGGCATATAGCAGCGCTGGGTCCATTCGAACTGTCGCCG
AGTTCTTGGAGGGAGGTGCCAGGTGCTTCAAGGAATCGTCGAGTCCGATGAACGGGGTTATCGACGCCTGGAGCAACTGGGCGAAGTCTACATCTCGCTC
ACGTACTCGTTTCACCTTCAAATCGTAGGGCGACAACATAACTGCGAAACTGACTGCGCGACCGTACAGCGACTTTGACTTAAACACCCACTCCAGCGTG
GAGAAACGGGTGTAGACGTGAAGTGTCTTTCGCGCCAAGAGAGTGTAGCACACTTTCAGCAATTGTAACAGCGCGACTACTTCTTTCTCAGCGGGATGAT
AGCCGAGTTCGTTCTCCTTTAGTACGCGTCCGCAGAAGCGAACTGGGTGCAGCTTGTCGTCGTGCGGTTGCATCAATGTACTGCTCAGTGCCCACTCATT
GGCGTACAACATGATATGGACTTCTTTCGCCGAATCGAAATGACGCAGAATTGGAGCTTCTGCTACCCGTCTTTCGAGCTCGGCGAATGACGCTTTTGCT
GACGCCAAGTCACCCCCAGGGCCAAAGTCCGTATCTTTGAGCTGATAGAGTACTGCTCCGTAAACAGCAAAGTTCTGGATGAATCGGCCGTAATAGTTGA
GGGCACCGAGGAAAGCTTGCATCCCCTTCTTTGATTTCGGGAAGGCGATCTCGGCGATCGCGGCTATCTTCTTCGCATCAGCGCGTATGCCACTCGGCGT
AATCTCGTGCGATAGGAAATCAACCTTGGGTTGGACAAAGATACTCTTGGTAAAGCTGATGCTAATTCGACATTCTGTGAACCGGGCTAGTAGTCGGTCG
AGTGTCTCCAAGCAGGCGTCGAGCGTCTCCCCTCCAAAACAGATATCATCGACAAACGACCTCCGCTTGAACACCGGAATCCAGGAAGACTGGTCTGGGT
TCTCCGTTAGCAAACATGTCGCCGTCCGGTCCGTTGACCAGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCAGCTTCAAATTTCGTCAGCT
GACGCTTCGTTGAATCACTGACTCCGCCGAGCTCGACTCGCCGAGTTCCCGACTCGGCTTCAGCAATAGTCATCCGTTCGGCAAACAGCTGCCATCCTCC
CTTTGGTTGAGCGTATCCCCATAGAGCGTTGTCGATCAGTCGCTGGTAAATCATAGGCGCATTCTTCAATCCAAACGGCATTCGTAACCATTCAAAGTGT
CCAAGTGCACAGACGAACGCTGAGATCTGCCGAACTCGGCGTGTCATCAAGACTGCCCAGAATCCACTCGCAGCATCGAGCGAGCAAAACCACAAGTAAC
TCTCCTATTCGGTAAGCAGGTCATCAACCAGTAGCATAGCGTATTCCATCGGCGTCGTAACCGCATTAACCAGTTTATAGTCAATGCATAGCCGAATATC
CACACCATTTTTCGTGAGCACTATCACCACTGGCGAGGCCCAAGGGCTGCCCGAAAACGATATCAACCCAGCTCGAAGTAGCCCCTTCAACAGA