Description :
From Genome Similarity Track
Location :
contig_4:101- 2576
Transcript NameFunction/comments
g1173.t1hypothetical protein
g1174.t1OWY98583.1 reverse transcriptase, partial [Phytophthora megakarya

Sequence
2475 bases(100 bases per row)
GCACCCGAAGCGAGCGATGGCCCTTCATGTGCAGTATGCGAAAACGCAACCTGCGCCGGTCCTGAGCAGGAGTCTCAGGACGCGTCCGATGTGGTCGAGC
ATGGGTTCCACGTCCCGATGAGCAGTGGTTCTCGGATGAAGACGATGATGACGTGGTCGAGCATGGTTTCCCACGTCCGGATGAGCAGTGGCTCTCCCCG
AAGAAGAAGATGACGTGGTCGAGCATGGGTTCCCACGTCCGAGTGATGATGTGGTTGAGCGTGGCCTCCCACTTGCGGTCGAGCATGGATTCCCGCGGGT
GGTCGAGCGAGAGCTCCCCGAAGAAGTTGACGCGGCCGAACAGCTGGCTCCGCGTCTTGGTGCCGATGTCGAGTTCCGGCACCCCGAGTCTGCTGACGTG
ATCGAGCATGGGTTCTCACTGTCAGCTGTGGAAGACTCTCCACGCCCGGTTCGTCGTCGCGGTCGTCGTAAACCGCGACGACCTCGTGCGCCGTCGCGGG
ATCCAGTCGAAGCTGAGACCGAGATGATCTCAGTCCTGGTGGGGAATGACGCGGACGAACCTCCGCGTGCGTGCAACGTCGAGGTCGCACGTCCTCCATG
CGACGCTGCCGAGATCACTCGACTGCCTGGCCTCTCGTGGAAACATTTCCTTCGCGACTTGAAGAAGGGCGAGATCGAACAAGTGTGCATGATCGTCGCC
GAAGACGCCGCATCCATCGCAGCCGTCGAGACCCACGCATCGGACTCAACGTCCGACGCTCGCACACGTCCGAAAGGTGCTGAGCCAAAGAACGCCCGCG
CAGCACGATACGCTGCCCAGTCGTTGCCGGCTCTAGAGGCTGCCGGCAACCCAGTCGCTCTTGTACGCGAGTTCAGCGACATCTTTCCGGACAAGGTTCC
AGCCGCCCTTCCACCCGATCGTGGCGTTCGGCACGAGATCGACCTCGTGCCAGGCGCGAAGTACTGTGTGACGCGGCAGTGGCCGCTTCCCCGAGATCAA
GTCGAAGCGATCGACGCTTTCTTCGAAGGTCGCCGGCAAGCCGGCCACGTCCGCGAGAGTCTGTCCCCGCATTCCAGCCCGACGTTCTGCGTGAAGAAAG
CCACCGGCGGATGGCGGATCGTCCACGCCTTCAACAAGCTCAACGACGCCACCATCCCGGCGCAGACGCCGATTCCGAGGAAAGACATGGTGCTCGACAC
CATGTCCGGCAGCACCAAGTTCAGCGCCATCGACCTGATGGATGGCTTCTACCAGATCTTGATGCGCGAAGCCGACGTGCCGTTGACTGCCGTCAGCACG
CCAGTGGAATGCTCTGGGAATGGCTCGTGATGCCGCAGGGGCTCAAGAACGCCCCTGCCACCTTCAATCGCATGGTGTCAAATCTGCTCCGGCCGTTCCG
CGACTTTGCGCCCAGCTACTTCGACGACATCTTCATTCACAGTCGTGCCGCGGGCGGCGTGACGGACGTCGAGATGCACCTTCAACACCTGAGGCAGGTG
TTCGAAGTGATGAGGAGAACAAGCTGTATGCCAACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGATCCCAGTGCTCGGGAGCTACGTCAGCACAGAAGG
TGTCCGTGCTGACCGGAGAAGATCGAAGCCATCTGCGCTTGGCCCGCTCCTCAGGATCAGAAGCAGCTCCGGCAGTGGCTTGGCCTCGCGACGTACCTCC
ACCACTACTCGAAGAACTTCGCGGCAACGATCCGTCCGTTGTCGCAGCTTCTGAAGGCAGATGCCGCGTGGTCGTGGCGTCCTGAGCACCAGTCGGCTTT
GACGCGGTGAAGACGAGCTTGTCCACCGCGCCCGTACTCATGCTTCCAGACCACTCGAAGCCCTTCCATGTCGTGTGCGACGCGAGCGACTTCGCGATCG
GCTGCGCCTTGATGCAGTTCGATGACGAAGGGCGCGAGCGGGTCATCAGTTACCAGTCGCGCCAGCTGAAGCCGGCAGAGCGGAATTATCCGGTCCATGA
TAAGGAGCTGCTGGCCATGCGGTACGCCCTCATCAAGTTCCGCGTATATCTCCTCGGCGAGCAGACCTTCGCGATCTACACCGACCACGCGTCGTTGAGA
ACAGCGACGAAGAGCCCTCACTTGTCCCAGCGCATGGCGCGCTGGCTCTCGCTATTCTCCGAGTACAACTTCGTCATCCACTACAAGCCGGCAAGGCCAA
CATCCTCGCCGACGCGCTCTCGCGTCGGCCAGACTACGTGCAGTCGGGTCGACACGCAGTTGGCGACGAGGATGACGACGAGTGCGCTGTGTGTGTTGCT
GAAGAGGTCGCTGCAGTGGAAGTCGCAGCGACTACTCCACTCCGAGACCTGATATCGGCCGCGTACGAGGCGGACGCGCGCGTGCTCCGAGATGATCAAG
TACTTGGGAGACCCGTCCGACACGGCGCGGCGCCGATTGTCCGCACGGAGCCGTGCCCGCATTGATCGATTACCA