Description :
From Genome Similarity Track
Location :
Scaffold_981:101- 2169
Sequence
2068 bases(100 bases per row)
AGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGGACCTCAGCTATGCTGAAGATGAAGAAGCGGGGCTTCTTGATGCGGAGCAGCGCGCCGGCATCCGCG
AATGCTCTGTGTGCAATAGCACTAAGCACTTGATGGCTTATTGCCTTCTGCGCGAGAAGCACGGGGCTCCGGCGAGCCAACTCTCCGGGTCATCGCCGGA
GAACGGCAACTCCCAGTAGGCACGGGGCGGCCTACTGGGGAAGAACTGAGTTATGTTGTGCCTCAAAGAGGTAGAGGGCAACGGGGCTCAGCCCCGAAGA
GAGCTGAGCTCTCTTACGAGAAGCGTGTGTGCAAGCCGGGCTTTGCTGGTCGGGCAAGCGAACGTGAAGGGCTTTACAAAGCCATGGAGAGTCTTAACTA
ACTCGGGAGCCTCGGGCAACTACGCTCGTCGCTCCACCCTGGAAGGGAGTCAGCTGTATGCTGAGGCACTGGAAGTGCCAGCGAGAGATATGATCACTGT
CCGTCTCGCGACGGGGATACTGGTAATTGTGTCGAAGGTCTCTGTCGATCTTGGAGTGAAGCTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTA
GACCTGGATGCGAGGTATGACCTCATCCTTGGCATGGCATGGCTGAAACGCCATGAGCCATGGATCGACTGTAAGTCAAAAACGCTGGGTGCGTCGCACC
CTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTTTGGTGCGAGCACGGGGCCGATGCGGCCGTAGTGCTGGA
CATTGGTATGTCCGAAAGTGTTAGCAACGAGGTTGTTGTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCTGAGCGGTGCAGGTCAGGTCAAT
AACCAACTGCTGGGTCCTGGTGAGGACGAACGCGGAGTGGCGCGTAATCCACTGAGTGGTACGAATCTGGTCGATGACCTACCGCTGCGTGGCCCGAGAT
TCGCGGGTCGAACTGCGAGTCGAGGCATCATGGGCGTGGCCCAGGAGATGCAGGTGAAGTGACACCTAGTTCACTGTGTGAAGGTCAAGGACCTCTTGGC
TTTCAGCCGTGTGTTTTGCGAGACACTGTATCCTCTTCGAGGAGTGATGGTGCTGCTGCACCCGGTGGTGGTGACGGAGATGTCGCTACACCGCCCTCAT
CCGGCCGGGCTCGGTCGCGGAGGGAGAGGAGAAGAAGACGCAGGGCGTCTGTGACGTCTTCGACGTCGGACGAGGTGTCCAACGTGACGAGCAGTGATGC
TCCATGTGATTGCTGTGAACAGCTGTATACACTCGTGAACGGAGTGACGGGGGAGGTAGAAGGCGATATCAGCCTTGACACTCTGCCCGCTGCAGAGGCT
CTGCTAGCGCTGGACGAGATGTCCATTGCCGAGTTTGGCGAAGCCTTGAAGGCAAGCGAGCTAGCCGAGGTGGTCCTGCTGGGACCTGAGGAGAAGTTGA
ACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTT
CTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGAAAGACCCACCGACGGGTCTGCCTCCGGATTAAGGCGTGTGTCATGAGATTGACCTGGTTCCT
GGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGC
GCGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCAC
TATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACATCATGGTAGGCTGTACGCTGTACAGCACGCTCGACTTGGTCGATGGCTACTAC
CAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTTCGCGCGGTATGCTCTGGGA