Description :
From Genome Similarity Track
Location :
Scaffold_1825:101- 1414
Transcript NameFunction/comments
Phymu_g13678hypothetical protein PHYSODRAFT_510353

Sequence
1313 bases(100 bases per row)
AATCCACTACACTGCCCCCGAAGCTTGGATCCACCGTTGGTATCTCCACGGCCACTGCATCAACCACTGCCGCTATTACCACCTTTGTAGTAATCAGTGT
CAGGTAGGTTACGTACAATGTCGCTTCGATCAATTCCAACGTGACCACTAACCGTTGTAATCATCACCAAAAGTAATCATTGCCAAGGTCTCTTTTCCCG
GTCGTCGTAGGAAAGAAAATGGGGATGCCATCGTACTCCTCAAGCACATAGCAGCGGTGCACTACCACACGGCCTCTAGTGGCGACGTCGGCGAGAATGA
CAAGGTGGATGTTCGCCATAAGGTGAAGTCGGACTGGGCTCCGTGCCCGTTGTAGAtgactctgcagcagcagcagtcattGATCTGGTCCTTCGGCCTG
AAGATGAAAGGGAGGAGTCTCTCAGAACATCCACTCGCCTCTCACTGGCTCCAGTCAACCGGACCTGGCGCTGTGTAGCCTCCAGCACAACCTCCATAGC
TCCAGCATTATCATCACTGCTTTGCCGGGATTGTCCGCTGGTCGGCTCTCTCACTTGTTTTCGGTTTCGCTTTCTAGCCGATAGTCGTCGTCGACTTGAA
CCCGCAGCAGCCGATGATGCCCGCGGTTCGTCGGTAGTAGTTGTAGTTGAGTCGACAGGCACTGAACTCGCAATGTCCTGTGTTCGATCTCCACACAGTT
TTGACCAATGCTCTGCGAGCTGTTGATCGTTTGCTTTGTCCACATAGTTTCCAACTAACCCACGAATGTCCTTAGCAAGGTTCTGCATTGGCTCGTACGA
GTCTTCAATCGACTGTAGGCCCTTCCAACCCACTAAGATATCGAAATCGCTGGTGTCAGCATTCCACTTGTGAGCCTTGAGGCTCTCGACGGCGAGCAAA
ATGCCCTGCGAAGCCACAAGCTCCAAGAGCTCATCTGTCACCTCGAGGCTGTCGTCAGCATAGAACTTTAGGCGCGAACCATGTACGTCCAACTCATCGC
CCGTGACAAGATGCTGTACAGCAAATGAGTGTGCGTCCGCGCGAACAACTCGGTAAGGGCCCACCCAATTCACTTGTAACTTGTTGCCATGGCGTTCATC
TACGCGAGACCTTAACACGCAATCACCAACGTCAAAGTTCACGAGGTTTTCACCTCTCTGTCGTTTCTGGTTTAGCAGGCGTTGCTTCAGGCGTTGGTCG
ACTACGGCGCGGTACATGGCTTGTATACTGTCCCGGAGTTGGGCAAGGTAgtcctcgatcttgtcaTTCTCGGGTACACTTTGCAACTCACCACTTCCAG
GGAGGTAAAACTC