Description :
From Genome Similarity Track
Location :
Scaffold_629:10099- 19358
Transcript NameFunction/comments
g7317.t1hypothetical protein
g7318.t1hypothetical protein
g7319.t1hypothetical protein

Sequence
9259 bases(100 bases per row)
TGCCGGTCTTCTCCGCCGCTTGCTGAATCGCTGCTGGAATGAGTGCAAATGCGCCGCGGTCGTGCTTTGAACCATGGAAAGCACGTGGCTAGCGATGCAT
TCGAGCGGATCCGCACGGCAGAGTTTGTGGCTCGTGTAGCTTCCTATCCGCATCAAAGTGGAGTCCACGATGGACCGCGTCGACGTGCAAGACATGGACT
CGGAGACGCAGCAGTGCCGCACCCAGCTTCTTCTCGACTAGCTGCGCGGTTTCACCAACGGGACAGCTGCTGCAGCCTGCCGTTGGGCCGTCGTGTTAGC
TATCAAGAGACTGTGCCAGAAAGAGACTCTGTACAGCGGGCGCACTTACGATCAGAAGAACCCAAATCCGTCCTTCATCCCAGAGCAGCTCGAACTCACG
TTTGATCGAATCAAGGTGCGCCTGAGCCGTGCGCGTCTCAAACGTCTCTGCATGGCGGGCTCCATCGAACGCGACCGTGCTGTAGTTGCCCGTGCCTTGT
AAACCAAACTGCCAGCTCGGAGTACCCGCTGCGGCACTGCTTTCACCATCGCTTGACGCTACAGATGAACATTACCGCGGCTATCTATCTCAACTTTCCA
GTTGTTTTGCACGGCAACAGACCACATGTGTTCGTCAAACTCAACGGCGTGTGCTCCAACAATAGGACCACGCAATACAACAGTATGTTCCCAATTCAAC
GTCATTCCCCCCACACTCCAATTGCAGCTTCCCATCGTCAATATGTTACCGTCGATAATCGCTACCTTCCAGTGCATGAGTCTGGGGCCTGCGTGATATA
CGTTGACCCCGTTTTCAACCAGTTTTTTTATCATTGCTGAGCTTTTCTCGGTGACTTGTGCCCGATCAACGAGAACACGAACCGTGACACGCTGGGAGGC
ACGGATGATAGCGTCGGTCAGTTCCGGATGCGACAAGATGAACATAGCGATATCTACTGAGGTCTCTGCGCCGTCGAGCAAATCAATGAGCTTCTGAGGT
GCAGCTTGGTCGCGAGAAAACCAGTAGTCTACAACTGCAGTTTGTAGTCTACCCAATATGTCCTGCTCCATGCGGCCAAATACTCGACGGTCGACCCCCA
TTATCCTTGCGATGTCCTTGAGCGATAGGGTTTGCGTGACGCTAAGACCTCGTTTCAGCATTTCCACCACGAAACGCATGGGGGTCCACCGACAGGGTTT
ACCGGACTTGGACTCGTCTTGATTGGGCTGGGCGTGGACGATGGCGTCGATCGTGCTGCGGGCGTGTCCTGTGCTTTGATGCAGCTGGGTAATTCTCTCC
CCTTTCTGGTATCGCATGCGAATCTGGGACTTCTCTGATGGGGTTAGTCGCGGACGGCGTTTCTTGGGCAGCGGACTTTGCGTTCTGTAGGCATTCGGCA
CGACGCGTCGCGAAGCAGTGTACATTTGACGTGCTAGGAAAAACGGAAGTGGCCCGACCTCCGATCCTCCACGTTGACTGAAATAATAATGGCTCGGAAA
GTCCGATCCTCGACGCTGCTGTTTAAATGGCTCGGAAAGTCGCAAAGTGGGCAACTTATCCTTTTTCATAGGATAAGTTGCCCACTTTGAAATTCCCGAG
CCAATTAATACAGCAAAAAAAAATGTTGGGCAGTGGGCAACTTATCCTCCACTGGAGTGTGAATTGCCCACTTTCCGACTTTCCGAGCCATTTAACCCTT
TCGCGACGCCCTTGGATAAAGTATACTATACAAGGTCAAGATACTCCGATCTAAAAGGGCACAAAATTCGCCCTTTAAGGTTTTCACGGTACTCGCGTGA
GGCTTGAGTGCTGTTCACTATCCTCCCGGATGCGGGATAGAGAAAGCCGGACGGTCTAAAAGGGTACAAAATTCGCCCTTTAAGGTTTTCACGGTAGTTT
CCAAAGACGCAGCGGATTGGCTCATATTTTTTTTTCTTGCGGCGACTAGACGAATTCGACGATCATTGGTTGAAATGCAACGAAATTTACGCAGTAAGAA
ATCGCAGCCTTCGTAAAATACCATACCAGTCTCGTCTCCGCGCGATGACGCGGTTGAAGCTGTGTACACGTCACTACGATGGCGACGCAAGCTAGTTGCC
CTGGGTTAGCGAGGCAGGCAGCCTGCCGCAGGCTAGCCGTGGTCTGTGCGGGACACGTCGTATGGACGTCTAGTGCAGTGGGGAAAGGTAGCTTAGCAGA
GGAATAGATAGACCAGAGAGTTGAGTTTACAAGGCTGGTTAGCAGAGATGAGCGCTGAACTGCTGTGCGCTTGGCTATTATGAATTGTGAGTTTTACTGA
TTTGGTCTTCCATATATGCATCTGATTGGGAAATCCTATGCCTGTCTGTTCCCGCTCTATCCATAAGCACCAATGGGAGTAAATATCTCTGTCTCACTAT
GCCGTTGACCGATTTACTCATCCAAAGAGACCCTGGGGTGAATTTTAGTTTTTGGCGCGAACCTATAAAATGATCACCTTCCCAAACCGATTGGTATCAA
TTAGAGTAATGAATAAATGATGCATGGCATCATAACTCTATTAATTTATGCCTTGAGACATAAAACCCATGCCGCTCGCAGGCCACACAACCGATTTTTC
TCCCTCGCGGGGATGCCGAAGCGCGACCGCGATGAAGCGCGAAAAATGATAGAGAAGCGTCCACGTCGACGGGTGCGCCACCTAGCGAGCGCAGCAAGCG
ATCTGGGCGGTGTCGTCGCATTCAATGACGTGTGGACATGGCTCAAGAAGTCTGGCTGGTATTCTAAACCGCCTCCCAGACGTAGTCTGGACCTGCGCTA
TCGCTACGTTCGACCGGATGGTGATGCAGACGGTCAAGAAGGCGTCGATTACCTTCTTGGCGAGGCTGCTGTTCTTCGGTATGCTGCCGCCCTCACAAGT
ACGAGTCTTGCTTGTGTGAACGTTCGCGGCGGTGGTGCTAACGACGCATGAGGGGTTGTTATGTCATCAGGGGGCAGAAACGACAACGGCAGCAACGAGC
TTGCCGAATCCAGGTCAAGAGTGGACGAAGATCGAGGGGGGCGCGAGCGCGGGCAAGTAGTGATGGCCGCGATGGCGGCCATGGTGTGGCACCGGGTGCG
TATCCGATTGATTCAAGAGTAGTGACTGCAGCTGATGATATTTGTGCGTGGTGGTGCGTAGCAGCAACAGGCAGTAACAAAGACGGCAGCGGTAATCTGG
CGGCATCCAGGCCAAGTGTGGATGGAGCTCAAAACAAACGCGGACACGGGCGTGGCAGTGGTGGTGGCAGCGACGGCGGACGTGGCAGTGGTGGCGGCGA
CGGCGGACGTGGCAGTAGTGGCGGCGACGGCGGACGTGGCATTGTTGGCGGCGATGGTGGATATGGCATTGCAGGCAGCGACGGCGGCCGTGGCAGTGGT
GCTCGCGCTCGTGGACGTGGAGGCGGCGACGGTGGACATGGTATTGTTGGCGGCGACGGCGGACGTGGCATTGCAGGCAGCGGCGGCGGCCGTGGCAGTG
GTGCTCGCGCTCATGGACGTGGTGTTGTTGCTCGCGATGATGGATATGGTAGTGTCAGTTGCGGCGGTGAATGTGGCATTGGTGGTGGTAATCGTGGCAG
TGGTGGCCGCGTCGGCGGACGTGGCAGTGATGAAGGACGTGGCGATGGAATGGGTGCGTAGTTGTCTTGTTGCCGTCTGCTGTTTAAGCATTCATCATGT
ATGTATTAATATGAATATTTGTATACTTGTTGTAGTATCAAGCGCTGTTCCTGGGACGCCACAAGCCACAACTCGGGGGCAAACGCCCGACTCGTTACAT
CGGACCCAGCCAGCGAGGACACCTCCGATAATGCTGCAGGAGGTATACATGAATAAGTTGGTGGCATTCACTCCGGAGCGCGAGACCTGGATGAAGTCCA
AGCTCTACCGCCCTATCGGACCGGCATACATTGTGGGGCGTGTTTGCCGACGTCCGATGCGAGGAAAGTTTGCGTCACTGTTTGAGATCCGCTGGCTGGA
TACTCAGTTCCAGAACGCTGTGGAACATGTGAGTGTCGGATGTGTTCAATCTGGAGTGGAGAACTACAAGGAGCTTACCCGGTTGAAGGACAACCCCGAC
TGGCAAGGGCTAGTAACGGGTGACGCCGACGATGACATTGACGTGGATGATGACGACAATTTGCAAGTGGTGGAAGAATACAGAGAATTTGATCCGGGTG
TTTTGCTTCCTGCCAATATGGAAGAAGTCGAAGCGATTCGAAATCTGCGATTTGAGCCCAACGGAGAAGTTGACGCGCCGACTGACCTCTACCAGCTAGC
CGACGGCTCAACGAAAACGACCCTTCTACCACAGTATAAACACCTGTTTGAACACTCGGCCACCTCCAGCTTTTTTGCGTACCTGCCTCTGTACTTCTGG
CGCCAAGTGCTGTTTGAGACGAACAAGTATGCTATTGTGCACGACATCAAAATTGGAGCACCATTCACACTCGCGGAGCTGATGGCGTTTCTAGGCATCA
TGTTTTATATGGCCTTGAACGACAAAGGTGAATATGCGAACTACTGGGGCCAACAACCAGAAGACCTGATATTTGGTGGGAACTCCGTCTCGCTGGATAG
CGTGATGTCTCTAAGTCGCTTCAAACTTCTGCGGTGCTGCCTGAGTTTCAATGCTGTACCGACCACACTGGATCGTGACGCTGCTGCTCGTATCCGACCT
CTACTAAACTTGCTGAAAGTGACTGGTGGTCTCTATGTCAAGGTTGGACGTAATGTGGCTTTGGACGAAGCCAGTATAGCGTGTCGGGCTCGACAAGGAA
GGCACATGATCGTGTTCAATCCCATGAAGCCAACGGGTAAATACCATTTTCGGTTCTATGTTGCCTGCTGCTCATCTACCTGGATCGCTCTAAACTACAA
GCTACATTGCAGTAGGTGTGATGTTGGCGACCGGCTCGATGGCGTAGTTGGACAGGAAGAAGCACTGTCGCTGCGAGTAGAATTTGACAAGGTGTCTAAG
ATTCGACAGCACGTGTTGGAGGTCGTGAGGCCATTTTTCGGTACTAACCGCATCATCAACATGGACAATTACTACACTTCGGTCCAACTGCTTCAAGAGC
TGAAGCTCAAAGGTCTTTACGGTCGAGGAACCATCAAATCTAACAGCAAGCACTTCCCTCGTCACACGATCCTGGATGATTCTAAATGTACGCGCGGCGA
CCTCCTCCAGGCCATCTCCCATGATTATAGCATGATCGCTGCGTCATGGTGCGACGGCGACATCGTCAACATGGTGTCGAATGCCGACCCATCTACGATT
ACACCTGTTACAAGAATGGTGGGCAATTCGTCACAAGAATTTGCTGCTCCGACATGCATAGGTCAGTACAACCAGAATATGCAAGGGGTGGACAGGTTGG
ACCAGATCCGAGGCAGATTTTCCATTGCAGATGGCCACTCCTTCAAGAAGTGGCATAAAAAACTTGCCTTAGCAATGATAGATATTGCTCGATCAAATGC
GTATTTGACGCGGCGGCTAGCAGGAGTCGGTCCTCCTGCGCGTGATCCACATCGCGAATTTGTCATGGATTTGGCGTGTCAGCTCATGAATGGCAAGTGG
ATCGAAGCTCCCAGCGAGGGTCGTATGGTGTACGGAACTAGTTCACTAAACGATGTCGTGGATGTGGAAGGCGTTGTGCCGACGCCAGTGTCGACCCCCA
GCGCGAACGTTCCCGTCCAGCGATGCACTGCCGTTGCCTCGAAGCAAATTCACAGCAAGAAGAGCCGGAAACGACGCAGATGTGTTGTGTGCCGCTGGGA
GGATCGCTACCCTACAGAGGTAACAACATACTGCCTTACTCACAGTGTGTCCTTGTGTCAAGAAGTAAACGAGAAGCCCCCAACGAGCTGGATGTGTCCA
CAGCAATCTTGGACATGTTGGGATAAATTTCACAGGTTTTATTTGCTCCAAGATCTGTTCACCGTGAAAGGTAACATTCGCAGGGGCTCGTCTCTAGCTC
AAGCTAAAAGCACTGCTGCTGAAAGTAATCCTACCAAGCGCAACCTACCTGAACCAAGCCCAAAGCCAGACGTTGTGCGTCAAATTATCTTATAGCTTCT
GTCGTCGGTGGGTGAGCTGCTGAAGCTGGCGCGATGCTGGCCAGGTTGTGCTGCTGCTGCTGCTGGATGGGATGGTTGTGCCATGGTGATGGTCGGGATG
ATGGTGTGAATATGCTGTCGGCCAAGCTATTGGTGTTCGTGCAGACGCGTTCCTCGCAGTGCTCAAGAAGTTTGTAGTATTGGTGGTTTTATCACTACCT
TTTGTTGTAAATATAGATCGGGGTCAAATTAGACTTCCAGCTGCATTCAACCATCCGTTCGTCGGCTAGCTTCCAGCGGAGACAGAATGGTTGCGAACAT
CTACCACTGTGTCGCGGACAGAAGCGAGCAGTCGCAACAATAATTCGTGCGTTTGGCATGGCGCTAAGTTCTTGGGCTACAAACAGCTTTGCTGATTCTT
CGAAAAGAAAGTAATTCGCGTAGATAATTGTAGCATCACAAGTTGGACTTCGTACAGATAGTGCCACGTCTCGTACGTCTGTAGCCTTCATGACCACCTT
CCGCAGAAGTGGGAATGAATCAGCATGTCTTTGAATGTGCTTTTCTCCGAGAGTACACAAATCAGAACGAACTTCGACCCCAACACATTTGCTGATGCAG
GTAGTAAGAGCAACTTGAGCTAGTACATTGCCAATACCAGCGCCCACATCAAGAAAGATGTCATGCGTGTTCAATGGCCCCAGAGCCGTGATCATGGCCG
CAACCCCGGATGGCAGCAACTCCCCCGCATTGTCTTGCGTTCTACCAGCGTCCTGGCGAATGTCTCCCGCAGTAATATTGCTAAATATCAAGGTCAGGAC
TCGTATTGCGTCATGCAGCGGGAGCAACGAAGAGCAAGACGTCGCTGGCAATCGGGGAGGAGCCTGAAGTTCCAGCACTGCGCTGACCGACTGCGTTCCC
AACGCATTACCAGGTCTCTTCACCACTGCGCACGCCGACGGCTCCAACGCGCAGATCAACTGCTCCATCGCCGGAGTGATCGACGAATCCGACGCGCCGC
CCAACTGCTCCATCACTGCACTGCTCGACGGCTTCATCACCGCAGCCGACCGCTTCGTCACTGCGCCCATCTGTCGCCTCACTACTGCATTGCCTGATGG
CTCCACCTTCCGCCTCACTGCTACGCTTCCTGACGACCCCACGTGCCGGGCATCTGCAGACGACAGCAAACACCGCTCTGGCGCTGATCCACCGAAAAAG
CAGCGCGGAAAGTCCTTGACGAACTTACCATACATCCGCTTGAGAGATGCGAGGCGCAGCCGAAGCTCGGCAGCTGTCCGCTTAGACTTGGTCATGCGAC
GCACCACGTAAGCCCATGTGATCCGAATGCCTTCCTTCTCAAACTCGTAGGCAATCTGAACAAGTTGTTTGTCTTCCCAATCGAGAAAGCTGGTGCGCAT
GGCTGAGGTAGTGCGTGTGTCTTAATTTAACTATAGCTCCACTGCAACTGAATGATGCATGTGTATAGCTGTTTGTAAGGCCACACAGTGACTGGCGCTG
AGGGGAGGGTTGATTCGGTAAGATAAAAAAAATGATGGGGATCCTCAGTTTATGAACGCAAATGGGTGACGTCGCACGTATTTTAAAGAGCCAGACCAAG
GCATGCGCTTGCACCCTCTGCTGTGATTGGTAGTAACAAAATACGTGAGTACGTCAGGCCTCAAAAAGCTAAAAGGGCACAAAATGCGCCCCTGGACACG
TCTCATTCGCACCATGTTTTGCAAAAACCCTTAAAGGGCGAAAAAAGTATCCTTTTAGCGCGAAAGGGTTAAACAGCAGCCAAAACATTATTTGGGCACT
ACCACGATGCACTCATCGCCTAGCCCTAAGTGCTCCCCGTCGTATTTTATCACTAAGTTCGTTTTGTATACAGCAAAATCGGAAAAATCGGCAAAAATTC
GACATCGTCTACCGCCACCACCTGGAGGGTGGCAATAGTTACGTACCTGTAAACTATTGCCACCCGGGGCAAAAATTCCTGCAAGTCTATTGACACCGAC
TCGAGGTTGGCCGTTAAAATTTATTGACCGACTTCGTTTGGCTTACCGGTATTACGGTGCCCCACATGGTACCGCGTACCACCGATAAAACCCATAAAAA
ATACACGATTACCGTAGTTTTACTCATAACGCACGATATTTACTGGTTCATCATTGTACCGTTCATGAAGCTGTGTGTCTGTTCTGGCTCAATCATGTAC
ACGTATTGGTCTTGCCTTCTCCCTCACGGATCACTCGCACGCCGTTTGCCGCACGCAGCTCATGATGTATCCAAATGAATGGCGAGTACACAACGTAATA
TAACCGTTATATTACTGACCATTATAAACAGAGGCCAGCTGAAAAACCACAATGAGATATGATTGGATGACCGTTATAAGCAGGTATTCGTAATAAGCCA
AGGAAGTCGGTAACCCCAGATTCAACATTTGAATGTCGGCTGAAGTGTAGTGCAGGAGCTATCCCTGTTGCCCAGTCCAGACATGGGATGGTCTGTCCGT
GCGGCTCTCTCAAGTCTAACCATTGTTGTCTAACTAAGCATTGCTGGGCGCACGCATCCTGTACGCGCTTCAATATTGCTCTCATGAACGCAGCCAATTC
GAAGGTGTTCTCGAAAGGTGTTGTTGGGTACGCCCGAGGCTTCGCAAGCCCTCACTTTTCACTTCGTTCCGTCAAACGCACTCGTCCAGTCTCCAAGCTC
CAGCGTCGCGCAAGTGCCATCCTCCGCGGGAGGTGAGGAGGAGGGCGAGGAGGAGGAAGTAAAAGATCGCTGAAGGAGTCCCGACAGCCAATCCAAAAAT
GCTATTCTTTGCGGAACTCCCAGCGCGGACGTGAGGCTCGAGGAGAATGCTCCGTCGACTCGAGAGCTGCGCAACGGATGTCACGTCATGTGACCTGAAC
GACGGGACTGAGCACCGTCCAAGTTTGCTTCAAGACAAGACATAGCAGAGTGTCGCCGTGTGCCTATCTGGAGGTGGGGAGGGTTTGCATGGCGATAGCC
GGCTCGGGCATGAGCCCTTTCGGGCTCTGTAGGCTACGTAGGTACCTATAGGACGCTCTTCAGGGATAATGGGTTAATTATCCATCTGGAACTGTTAACC
ACGGGGCTGACGCTTCATTCCGCCTGAAAGCATGGTCCTCTCGATCATAACTTCTCCAT