Description :
From Genome Similarity Track
Location :
Scaffold_40:10097- 14218
Transcript NameFunction/comments
Physo_108891cellulose 1,4-beta-cellobiosidase precursor
Physo_135666cellobiohydrolase I
Physo_135667cellobiohydrolase I

Sequence
4121 bases(100 bases per row)
CGGTCGACACGGAGGCTGCGTCGGTCGACACGGAGGCTGCGTCGGCCGACACTGAGACCGAGTCGGCTCCTGCTACGACCACCAGCTCGTGCAAGCGCCG
TAAGTAGATGCTTTATTAAGCTCGGATGTCTGAAAGATGATTATGTGTTGAGCGAAGATCTAAAGCAACCGTAGATGGCCTTAGAAATCCCTAATGGAAA
ATGTTTGTTGTTGTCAAGTCTCAGTTGGTCTACGTGTTCACTCGTCTTTGGTGACAAATCTTCTCGTCCTTAGCCCAGATATCGGTATCATCAACCTTCA
ATGCACAAACAGTTTATTTTTCGTTAAGGGGTCGAACAACTCGACCTTCCACGTGAGGCCGAACACTTTAGATCTTACTCTTACTCTTACGACTACGATA
CGCACGACACACAGTCCTGAATCATGTTCACTTGGATGGCACTCGTCCGCTCCTAGTGACGGCGCGCACGGACCTTATACGAACTTGTCGACGTGGCCGG
CACCGACGTACTGGTCGAAGTGGTGGAGTCGGCATTGGCTTCGGAGCTCTCTTCAGAGTCGAGTTGGCATCCGCATCGACTTCGGAGGCTGAGTCGGTCT
GATTGTCAGCCTCGTTGGCCGCTGAGGAAGAAGTGGACGTTGAAGCGTCCAACGAAGTAGTAGACGACGATGTGGACGGAGAAGTCGTCGTTGTGGACGT
ACTGGTGGACGTTGAAGCGTCCGTGGAATCGGTTGACGTGGACGACGCCGTAGTTGAAGTGGAAGTCGACGAGCCCGACGATGTCGATGTGGACGGGGAA
GTTGACGTACCGGTGGACTTCGAAGCGTCCGACGAGCTGATACCGTCCACCGTAGTGCCAATGTCACCGAAGCGGATGTTGCTGAACACGACAGTGGCAT
CCAGCTGCTCCGAGATAACATCATCAGGGACACCCGACGTCTTGGCGCACGTACCGCGCGAGACACCGGGCTCGGAGGCGTCAGCAGTCACGGGGTAGTC
CGAGTCCAGCCACAGGCAGTAGGCGGCGTTGTCCGTCCACAGACTCATGGTCAACACCATGCCGCGCTTCATGGCGAGCCCGAGCTGAGCAAGTCCGCCC
TTGGCCTTGTGGTCGTCCTCGTCGCCGAACTCCGTCTTTGCTGCTGAGCACTGGGACTCCGTTAACGTTCATGTCCTCGATGCCCGACCACGTCGCGTAG
GGCATCTCGTAGCTGACGTCGCCCTGCACGTAGAAGCGAGTGATCTCACTCAGCGTACCCGTCGCAGTGCCATCGTCCGTGATGAACCGCGTCACGACCG
TGAACGATTTCGTCGTATCTATCGTGTAATCCGATCCGGGGCCGAAGAACGTCTTGTTGCCCATTCGGTACGGGTTGAAGTCGCAGCCGTCCTTATCGCA
AACTCCGTTATAACGATCGTCCCCGGAGCCGCATTCGGTGGCGCTTTCACAGCGGTACGAGCCTCCAGCGCTCGACGTCACCGAGCAGGGGTGCGAGGTG
TAGGCGTTGCTGATGCTGTTGGACTGCCAAATGTCCATCTCGGCACAGCACGAGCCGTATTCGCCAGTGCCAGAGTTGCTGTCAGTGGCACTGGCCGTCC
AGTTGAGGACATTGACCTCACCGCTGATGAACTTCAGGTCTTGCGGGCACTGCGCGTCACAGTAACCCGTGCCGTACTTGTCCCCGGCAGCATTGCCGGA
GAACCGACTCATTCCACCGTCGGTGTCCATGTCGACGAAGTACAGGGCGCCGTTGAGACCGCAGTCCAAGTTGGACACGTCCACGTCGAACGTGAATTCC
TGGTTCAGCAGCATGTAAGCCTTGTACGTGTCGTCCGACTCCATGACGTACACGCGCGAACCGATGTTGGTGCTGTACGCACTGTCGGTCACCAGCTTGA
GCGTGAGGCTGTCCGTGTCAGCGGTGATACCGTAGGCCCCAGTGTAGTCGGCACCGTCAAGAGCGCAGTTAGACGCGCACGTCTCGGGGTCGGAGCAAAT
GGTTTCATCCCATTCGTTGCCCGTGTAGCAGTTCGTGGACGTGCCGACCTCGTACAACCAGCGCCAGTTGGCTGCTCGTGCAGCTCTGCGTAGTAAGCGA
CGGGTGACTCTCAGCCGTGTTGGAACCAGCCTGCTGCGCGGTCGTGGTCATGGTGACGAGCGAGGCCGTCGCGGCGATCGCCACGAGGCGAAGGGTGCTC
GTGTTGGTTTGTAGCTTGTGGTTGAGGGGGCAAATCCCGAAGTGAGATTAAATGTTATCGTCTCTCAAACTACTCTCTAGTCTTCCCCTCCTGCTTTCCT
TCTTGTGCTCCTTGTGCTCGTTGGTGCCTCTCATCAGACGGATTACTCCCGGGTTCCGATTGACTTGATCTCAGTATACTTGGTCTCCCTGACCAGCCAT
TGGTATATCCAGAGCCCGGCTGCCGCCGGCTCTCCCGTCGCCGTCGGATCCTCCGAGTCATCGGCGGATGTGTCCACACGTTCTCCTCGTCCATGTGCCT
CTATTGGCGGCGCTCCCGAAGACTCATGAACAGCTCCGAGTCTGCATCATTGACAAATTCTAGAGTAGAGGACGATGTGCTTCGGCGGAGGCAAATTGAA
TTGTGAATGGCGGAGACAAGCTCGTTGGCTGGGCAGCGCTCATGCGCGATCACCAGGGACTGGTCTCAAGTGCCGTAGGGGATGACCACGACAAGCCCAG
GTCCACATCAACAGGTATCTGCTGCCGCCCAGCTGCTTTGGCGATATCTTCCTCCGTGCGAGCAATATCGCTCTTCATCAACTATCTTGCTCTCCTCTAC
CCGAGGCGATGGAGCTTTCTAAGGTTACGAAATCTTTGCAGTGGCGACTTTGCATTGAGGCGCGTGTCCGACTCGAGTGTCAGTCAGGATCGGCTTCAAC
TTCAGCCTCGACTGGCCGAATGGAAACAGGTTGTTAGCCGGAATCAATCTGATGCATCGCGATCACATCAACCGTGAGCACTGTTGTCAGCAGCTTGCGT
GTGAGGAGGCACTTACCAGTCCTTCTTTCGTGCGAAACACAACAGCAATTTGTGAATTTCTTCATTGACGTTTTCAAAGCCGACTTGTGTTGGTATGGTT
GCGAAGTACAGCTTTTTCCCCAACTGATAAAAAAGAAAGAAGAGGTCTCCATCAAGATTGCAAATGTCTGAATTAAGACTATGAAACAAACTACAACTCG
ACCCATTCGCTGTTGCTCTGCTCACAACTTTGGCCGTTGCTGCTCAACACTCCACTATAACAACTATGTATCTCGAAATGCACACGTCACCACCGAAATG
CAACGTCTAACCATCAACGCCAACGCCTAATAGCGCTTCGTCTTGCACTGCTTGGTCGGCGCCTTGCTCGTGCTCGCTGGGGCGTTAGTACCAGTACCTT
CCGATTCAGAGCCAGTTGTCAACGCGCTGTCAGCATCGGTGCTTGCATCCACCGTTGTCGACGCGCTGTCAGCACCGGTGCTTGCATCCATCGGCACCGC
CGTCGAGCTGGTATCCTGACTTGATTCCGAGGCTACAGACGAAGTGGAGTCAATGCCAGCATCCGTGCTAGTTTCATCGCTCGCATCCGTTGAAATTGCT
GAGTTCGTCGATGAAGACGACGCAATTGAAGCTGACGGAGCAGAGGTTCTGGTGGATGACGAGGCGCCCGATGCACTCATTTCGGTTGCCGTGCTGCTGC
TGGTCGATCCAGCGCTGATACCATCAACGGTTGTGCCAATATCGCCGAAGCGGATGTTGCTGAAGACAACAGTAGCGTCGGCCTGCTCGGAGACGACCGT
GTCCGGGTCACCGCTCGTCTTAGCGCACGTGCCACGAGCCACACCAGCCTTCGACGCATCGGCGGTGACCGGATAGTCTGAGTCCAGCCACAGGCACTTC
GCGGCGTGCGTGATCCGTCCACAAGCTCATGGTGAGCACCATGGCTCGCTTCATCGCGACACCGAGCTGAGCAAGTCCACCCTTAACCTTGTGGTCGTCC
TTATCGCCGAACAACTTCTTCGCTGCAGAGCACTGGTCGTCTGTCAGCGAGTTCATGTCCGTAAGACCCGGCCAAGTGGAGTACGGCATCTCGTAGGTTG
TGCCGTCCTGGATGTAGAACC