Description :
From Genome Similarity Track
Location :
Scaffold_186:100947- 105692
Sequence
4745 bases(100 bases per row)
TCGAAGTGGACGATGCCATTTAGGCTTGCCGCATTGACGACGAGGAAATGCAAGTTACATTTTCCAAATTGAATTTGTCAGGGCGTGCCATAACTTGGGC
CCTGAATCTTCAACTACATGATCCAAACGTGTTTGGATCGTTGGCGGTCTTTAAGACTCTGCTCAGCCAAACGATTGAGCCGCCAAGAGCTGAGTTCAGG
ACCTTTTCAGAGCTCCTGAACATAAAACAAAGTAATCGTGACGTTCACGCTTACGCTCAGCACGATCGTTACCTTGCAAGTTGCATGGTAGCGAATCCTG
TAAGTGAATTCGTGTTGATCACGATATTCTTACAGGGCCTCATAGCTGGTCCCGTGAGGAACCACCTATTCCGCATCGAGTTGAAGTCGCTTGAGGAAGC
GATTACAACTGTGGTACAAGAAGACTATAGTGTGAGACAGGCTAGCACTAGCTTGACCCCCTATCGTACTTCGAGACGAGTAGAGGCGGGAGGTCCAGAA
CCAATGGATCTCTGTAGTGTCGAGAGCGAGAGACCTCGCTCTTCAAGCAGTAAGCGATTGCAAAAGTGGAATCGCTGTCAGAAGTTAGGACATTACGCTT
ACGAGTGTAGTGCTTCACGCCCAGTGTCTCGAAACACTGAGCGAAGTGATCGACCGTCTGCCAAGAAGGGCAACGGACGCGGGTCCGCCGCTATTGCGAA
GTCACAACAGCGTAGCGGACTGTCAAAAAACGGTCGGAGTCAGTGGTGGCGGAGCGCCTTACTGATCTAGCAACCTCAAAAGAATTTGCAATCCCATTGA
TGAAAGCTGCTCCAGACTCACAAATCCATGTGTGTCTCTGCACTTGGTGATGAGGTACCCGTCATCACCTTGAATTTAGAAGTGACAAAAGATTTGTCAC
TTCGTGCTTTAGTTGACTGTGGGGCGTCGAACAACTTTGTTAGTCGCCAGTCGCTAGAGGACCGTAGGCTCAAGTTCGTTGAGCGCTTCACTATTTCAAT
GCGGCTGACGGTGCGCCTCGCAACAGGCGCATCCATAGTAGTAATGAAAAGTGTAGTGGGATTTCACTACACGTTAGAAGATTTGCATTACAATGATGAT
TTCATCGTACTTGTTTGGAGGACAAATTTGATGTCATCCTAGGGTTACCCTAGCTTAGAAGGTACGAGCCAAGGGTCAGCTGGCAGCATCGAACTGAGAA
GATGCCTGCCACTTGTTCATCAGATGGCCATCAGATGAACGTCTTGGAGCATTCACAAGCGTATGGATGTACTGCGAGTGAGTACGATGTACTGCGAGTG
AGTGCGATGGCCTCACTTGCGGTACAGTCGTTAGTACGACTGCACAAGATCACAGTGTCACTACCAATCACACTGTGGAGGAAGCTGCCGGCGGCTGTGC
AGCAAAGACAGCGCCGAAGGTCCACCACTCAAATAAGTCGAGTGGACCGGGCATGGGTGTACGCCTAGCGGCGATATCCTACTAATAATAAACCAGTTGC
TAACACAGGGAAACACGATGATCCTAGACCAGCTGGAGAGTCGATCGTAGAGGACGTAGCTGTGGTAGCGCAACCACAGCTAGAAGACGTCGAGGGAATA
AGTCCCCACGTACTTGTGAAAAAAGGCTTCCAGAAATAAACTGAGACATTGAATGTCTTGGTTAATGACGGGTAAAGTGTAGGTGCTTATACATTTGATC
TGATCGCACCTCCGAAGTTTACTTCGAAGATTACTCAATTGGCAACCGCTAGAACCGAAAACGGTTCTTGTGAGATCTGCGTAGTGGCAAGGTCAAACAG
ATCTGTGTACTCGTCATGGAAGATGAGTACGTGACTGACATTCGGTCGGCAGTAATATTTGCTGAGAACGAACGGGTTCTCTGCAGCTCATCATTACACG
AAAGTGTCCTCGATAAGAAGACTCGGATTGAGAGATACACGTCTCAATCTTGAGAGTCAATTCAGGAAATTCCTTTGTATAAGGATTCGATCGAATTCAA
GGACGTGTTCCCTAAATCCGTACCATGAGAATTGCTTAAGGATAAAGACACTCGACATGAAATGGAGCTCAAACCGGGCTTGAACTACTGTGTCATGAAG
CAGTGACCACTGCCTCGTAAACTAGTACTTGCGATCGACAAGTTCTTTACCGATTGCTTAGCTGCGGGTCATGTGAGGGATACAACTTCCTCTCACAGCT
CTCCAACCTTCTGTGTGCGCAATGCCACAGGGGGATGGCGGATAGTGCACGCGTTCAACAAGTTGAATGCTGCAACGGTACCAGCTCAGACGCCGATACC
GAGGAAGGACGTAATCATTGATGGTATGTCAAAGAGTACCATCTTTTCGTCCATGGATCTGATGGATGGATTCTATCAGATCCTAATGCGTGAACAAGAC
ATCCCGTACACGGCAGTAAGCACCCCGAGCGGCATGCTCCTGGAGTGGCTATTAATGCCACAAGGGCTTAGAAACGTCCCTGCCACCTTCAACAGATGTG
TTACATATCTGTTGAGACCGGTGCGAAACTTCGCACCGAGTTACTTCGACGATGTATTCGTCCATAGCTAAGGTATGGGCAGGAAGACGGACGTAGAGGT
TCATAGGACGCACGTTCGTCAGGTTCTTACATTTATACGCAAACATAAGCTGTACGCCAACCTCAAGAAGTGTATATTCGCTTCTAGCGAGATACCACTT
CTTGAATGCATCGTAGGTAAACACGGCATACGCCCCTGATCCAGGAAAATCAAGGTGATTACCGGCTGGCATGTGCCAGTCAACGCTAAGGGACTAAGAA
AGTTCCTTGGTCTAGCGGCTTACTTACACAGGTACTCGCGCAACTACGCTGAGATGACTGTTCATTTCTCTCGTCTCTTGACAAAGAACGAGAATTGGTC
ATGGAACGCTGATTGTCAGCGTTCTTTTGAAGGTATCAAGCAGAGCTTGATGCAATCGCCCATCTTGGCAATTGCAGACCAAGACAGACCATTCCATGTG
GTCTGTGACGCCATCGATTTCGCAATCGGCTGCACTAATGCAGTACGATGCCGACGGCGCAGAGCGCGTCGTCTGTTATCAATCTGCGGAGTACAAACTT
TCCGTGGAGTATAAACCCGGACGACTCCATTGTGTTGCGGATGCATTGTCGCGCCGACCCTATTTCGATTCGGCTGCAAAGTCGAACAGTGGGGTTAATA
CCACTGTTGCAACACTAGCCACTAGTGTTCCGTCGTCAACATTGCATGACGATATAAAAAAGGCTTACGCAGAAGATAAGGCTCTTCTACGACTAGCGGA
TCATCTGGTGACTCCATCTTGTAGATCTCTTAAAGATTAACCGGCCTTGAATTAATCTTCCGTGGATCAATACACAACACGCAACGGGTTTCTGTATTAT
ACAGGCGTTGCCGGCAAACACACCTCGTGTTTTCGTCCCCAATTCATAATGATTTGTGCTTGCGAATCTTATATGAGTACCATGATGCACCACCTAGTGA
GCATCGTGGGTGTGAGAAGACTTATGTCGCGGTAAGTCGCGATTTTTACTAGCCCCGCCAGTATCAGTTTGTGCGCAAGTACATTCGTGCTTGTGAAGTG
TGCAACCGGGTGAAGCCCAGTCCTTCATCCCGTGCGCCACTACAGCCACTTCCAATCCCGACAGAGTGCTGGCAGTCCGTTTCAAGGACTTCGTCTCCGG
TTTCCCATAAGGACGCTCACAAAAATAACGATCTTCTTGTGTTCGTAGACCGATTCAGCAAGATGGTACATCTTGCTTATTAATGAGTCAATCTCAGCAC
ATGGTTGTGCCTTTATTGACACAGTATTCCGACTACACGGTCTAACCTGTGAACTAGTCTCTGATAGAGATCCTCGGTTCATGGCGACGTTTTGGCAATC
TGCGTTCGGATCTCTCGAAACACGTCTGACCATGCCTACTTCTGACCATCCCGAGACTGATGGTCATACAGAACGCGTCAAGCGCGTCCTCAAAGAGATA
ATTCGAGGATACGTCCAATCTTTCACAGATTGGACCGAATATTTGCTGATGGTGGAGTTTGCAATTACAACCGCGTATATGCTTCGACAACGCATACACC
ATTCTTCGTGGATGGCTTACTCCATCCACGCCTACCCTCCCTCGTATAGTGTCACTCTGGTTCAAGGGGTGAAGGATTCGCTCGAGCGAAAACCGTTCTG
GATTTGCTCATCACGTGTCGATCTAATCGACATCGAAGAAGATAAACTTAGCAGTAGTGACGATACTTTTGCTGACCCAAAGGAGGATGACGATGCTGGT
ATATAGCATTGCCAATGACTACACCAGCGAGGATGAGAACACCCTCGCTGAAATAGAGGATGACCTCCTAGCTGTGCGCACAAGGTGCACTGCAACAAAC
CAAACTGATTCAGCAGAAGATTTTCTGCTGGCACGAGAAGCTGTGGACCGTTTCATGCAAGTCTCCATCGCTAACGCGAAGGACCGGTAAAAATGGAACG
CTGACAAACATGGAAGAGCAAACGTTCTTCAATTTAATGTCGGAGACTTAGCTTTACTTTCTACGGTAAATCTAACTAAGCACGTAGTAACTAAGGTGGG
CAGTACTAAACTACTACCCGATTACATTTGCCCGTTCCGTGTACTACGTCGCAAAGTCATTGCGTACACAATCGAGTTGCCTCGCAGGATGCGTACACAT
TCTACGTTTTATGTCGGTCTTCTACGCCCGTACCAGCACCACAAG