Description :
From Genome Similarity Track
Location :
Scaffold_67:100934- 103658
Transcript NameFunction/comments
Phyke_g5352hypothetical protein

Sequence
2724 bases(100 bases per row)
CTTGGCAACGTCTTCGTCAACCGATCAGGTCGAGCGCATCAATGCGTTCGCCAAATATGAACGTGGGCTGGTCGCACACGTTTGCGGAAGCATGCAAGCG
TCCGTGGCTGCGCCGAAGCCGGCACAACCTAAGCCTTTGAGGCTGAACGTTTCTCCCTATGAAGGAaaggagggggggggggcttcACTTATGAGTCCAA
GAAGTGGACATCGCCATGCAGGCAGGTCTCTTCTCTGACGAGTCACTTTGCGTGGCTTTTGTGTTGTCCAAGTTGGGTGGTCGTGCCAAGGATTGGGGAT
TCACCATGGAGACTACGTCTTCTGGATGCTTTACATATTTCACTTAAttggtggagcagctgcttgctgcattCCTGCCGGCGAACATTGAGTATCGTCA
GTGCTCACACTTCCTCGCCTGCAAGCAAGGAAGGCGTGAGCTGCACGAGTACGTGCAGGAGATGCGcgtcttggcagcttctttGGTGGGGAACCCCTAC
CGGAAGACATCAAGGTGACTGTCTTCATGGAGGGTCTACGAGTAGGCCCGGCGCGAACGCAACTGTTCCGCACACATGCATCCACTATGGAAGCGGCGAT
TCAGGTCACTCTTCAAGAGGAGTACAGCCATAAGCAGGCTCAAACTCTTACAGCCACCTGGCAGGCGCCTGTAAACAATGGGCCGGTACCAATGGATTTG
GGCACGACCGAGCAGAGCAATATCCGCTGCTTTGGAGGCGGAAAGATGGGGCACATGCAACGTGCCTGTCCTGCGGGAGGACGTGGAAGGCGACTCTTCC
AAAGACCCCAGGGTTGACCCCAAGGTCCCAGGGGACAGGGGGACACAGGACACCAGTAGGGGCGGAGCGCCCTGCTGGGGAAGACCTGAGTCGTCATGGC
GGGTGCGCAGGTGGCGCGCACCATGGTGGCTTAGCCCCGGAGAGACTGTGTTCTCTCCATGAGGAGAAGGGCAGCAGAGGGCTGCTTGTAGTACACGCAA
ATGTACGGGGATATGATCATCCCTTGAGAGTGTTGATCGACTCTGGAGCCTCGAAGAACTTTGCTCGAAGACAATATGTTGCACGCAACAGTAACAAGTT
CTCCGATGCTCTACGCGAGAGTGAAGGAAACGGGCTGGTATCAGTAAGACTAGCTGGTGGTGCAATGGTAAGAGTACCGAGGGTCTGTATGGACCTAGCT
GTCAAGTTCGAGGACTTTGACAGCGTCGAGCCATTCATGGTCCTTAACATGGACAAGTATGACTTGATTCTGGGCATGCCGTGGCTTGAGAAGCACGAAC
CCTAGATATATTGGCGTGGAAAAGCCATAGGAGCGAGTAAGACTCTGGTATCTGACGGAGCTTTGGTGAGTCATGTTCCCACCTCTGCCAGATGACATGG
CATCCGTAAGGATGACCGATACGTAAATCCGTCTGAAGAATACATGGGTGTTGTCGAGGCAGTTGCCGACAACAgagaagcagttgcagtggGCGCTGCA
ACTGGTCGCAAAACCTTGTCTAACGCGAGCTTTGCTCGCAGGCCACCAGAGGCTAGGTCGGTGGACGAGACTTCCAGCCACGCGCTCAAAGCGCAAGGCC
ATAATGCCGAGACTCAGGAAGAGTCGGAAGCGGAGACTACCACGTCGGTAGGTCTCTGCATTCAATGCTGTCGCGCCGTGCAGGCTTCGACAGTGACGGT
GCCGACTGACACGCATCAAGTGGATAACATTGGTCCACATGCGGGTAAAAGAGTACCACAGGCAGCCAAAGCTATAAAGGAGGCCGAAGTTGGCACATCC
AAGGTGGGCAACATAGTTCCACACGAGGTCACTCAGACCGAAACTGATCAGGAGGCCGTGGATGGTTCTCCGGTTGTGGGTAACATAGTTCCGCATGGAG
TCACTCGAACTCCTAAGGGTGGCACCATGGCGGTGTTGTCGGGCGTGGGTAACAGAGCACCACATcccaagaagcagcacaagacgCGAGGGGTATGGTG
GAATATCAGCCCAAGATCGAAGCAATTGATCAGGAGCCCTTAGCCCAGGTTCCACCAACATGACCAATCGAGGAGTGTTATCACATCCTTGATGGAGTGA
CCGGTCTACATGTCAAGGCAAAAAGCGTCCACTTGGAGCCACTGCCCGAGGTCTCAGAGTTGATGAACCTCGAGGAGTTGTCgttcaacaacttcttggC
GGAACTAAAAGCCGGGGAGATCTCAGAGTTGGTACTCATACGTTCTAAACCCACTCCTAAAGAGGCGAACTTTTCCTCTgtcatggacgaggacgtCCTG
GAAGAGATTCGCAAGCAACGCGCGGTGCACTCTGGTTCTGAGACTATCAAGAACCCGAAGGATCCAGTGTATCCATTGCTGAAGGAATTCGGGGACAGCA
TATCGAAGAATCCACCATCCCGACTCCCTCCAGACCAAGGGATCCGGCATAAGATTGACCTTGTGTCTGGCACCAAGTACTGTGTCACGCGACAGTGACC
ACTGCCACGTGAACAGTGCGAGGTCATTGATGCCTTCTTTGCCGCGAAGACAAAGGCAGGCATGGCACAGGAGTCTAAGTCCCCACATTCGACGCCTACC
TTCTGTGTCCGTAAAGCGAACGGAAAATGGCGTCTAGTTCACGCTTacaacaagttgaacaaTGCGACGGTACCGGTTCAGACGCCCATACCTCGCAAGG
ATGTTCTCCTGAACAACATGGTAG