Description :
From Genome Similarity Track
Location :
Scaffold_322:100924- 102871
Transcript NameFunction/comments
Aphin_H310_00015DWNN domain isoform 2
Aphin_H310_00016dihydroxy-acid dehydratase, putative

Sequence
1947 bases(100 bases per row)
CTTCAACCGACAAAGCATGCAGCGCCATGGCCAGCTCGACCGATTGTTCAATTTTCCTTAGTCCTGGTACCTCGTGACAGCACGGAATGAGCACCGCGTC
TTGCATGAGCCGTTTACAAATCGGACACGCCAAGTGGTCCGGTGGGACCAGACGATACTGGTCAATGCCGGACCCGCCGCCAGATGACTTGACCAATTTC
TCGAACGCCTTCACTTGGGGCACGACGATGGCGAGGCCACCGTTGGGCCCAGTGTTGACGACAGTAAACCCTGGCGCTTGGTTTGGGCCCTCCACGGCTT
TGATCAGACTGGTTGGGATGCCCGTGCGAGGCTTCACCATGTGCTTGTCGTGGTTCGCGTTGCCGTTCGTGGGGCAGTTCTGGATGAAATGGCCGGGAAC
ACCGCACCGGTAGCACACGTAGCCTTGCGGTGGAGTATCCAACAAGTTGTCGCCAGGAAGAGGCTGCGAAGGGCCGCCACCACGACCGCCCATGGGAGGA
GGACCACGGCCTCCATAGCCGCCGCCCCGACCGCCAGCATACATCCCAGGCGGCCCCCCTTTGAATCCCGCACCACCTGTCGCCGTCCATGTCTTGTTTC
CGCCACCGCGCATGCTTCGAGCTTCTTCGGCTTCTTGCTGGATTGCATTCAGTGCTTCCAGTTCGTCTTCCACTGTTTCGGCACCGCCAGATGCCGTCGT
CGCTTGGCCGTCCGATTCGTTCAGGCTTGGCTAGGGAAACATCGCGTGAGTACAATCTGTTGTTGTTAAGGTACTGGAGTCGTACCAAAGCAGGAGCTAC
CGGGGGAACGGGAAGAAGAGTATGGGGGGGAGCTCTAAGTCAGTCAAATAACCACCATGCAGCGGCGTAAGGACGTCGGAAGGGCTGGGTCGACTCGAAG
AAAAACAGTATTATTGATGTGATCAAACAAGCAAGACATCGAGGGGTGACAACATGCAGTAGGCACAGGAGAAGGATGCAGTACGCACAAGGCTTTTTGT
TCGGCGGCGATGCGAGCCAGGATCCCCACATTATTCTTCGCTGGCATGCGCTTCACTATCACGCTCGTGTTCTTCGTCAATTGCTGATTGTCGTCTTCGT
ACACTACGGCCACCGTGTTCATGTCAAACCCACGCAAACACTTGCCCGGTCATGCTTTACCAGTGTTGTTTTGAAAGTCCGTGATCACGAGTTCCATGTC
TTGGCCTTTGTTGAGCTTCTTCTGCTCGATGATGCCCTTCTTCAGGTCAATGACCCGAATGGTGGTGCCTGGGAAGTTAATTGTCCCGAACTCCTTCTCG
GACTTGAACTTGAAGTGCACCGACATGGCGCTCTGTCCTCTTCCCTGCGGCGGCCGGCGAGAGCTTCTGCTTGCTCTCTCCACACAAACGGGAAATATCA
AATTTCACAGACCTGCAACCACCGCAACTTTATTCCTTTCCACTGGTATCCGAATCCGGATACTGGGCAACCGGAGTGTCAACTTGGCGTGCACTTTGAC
ACCACTCGCCTGGCCGGTATGCTGGTCCATGGGAAATGGCGCCGCCATTCCATGCAGTTTGCGCGCCGTGCTATGAGCTCAAAGGCTGTTAAAGAGGACA
AGGTGAAGCTGAACAAGTTTAGCTCCGTCTTGACTGAACACAAGTCCCGGGGAGCGGCCCAAGCGATGTTGTACGCCACCGGTATCAACGAGGAGGACCT
GACCAAGCCGCAAGTCGGGATTGCTAGCATGTGGTGGGAAGGCAATCCTTGCAACATGCATCTCCTGGATCTTGCGAACGAGATCAAGACTGGTGTCCAA
CAAGCTGGCATGGTTGGGTATCGCTTCAACACGGTTGGTGTCAGCGACGTCATTGCTCAGTAAGTCCATCGCTTCTATTTGACCGAACACTAAGCGTCCT
GCTTTAGAGGCACGGCTGGTATGTCGTATAGCTTGCCCTCGCGAGAC