Description :
From Genome Similarity Track
Location :
scaffold_42:100918- 103033
Transcript NameFunction/comments
g11250.t1hypothetical protein

Sequence
2115 bases(100 bases per row)
GAATTCATCATGTGGTAGCCGGATCGGGTATCCAGCTCTTGCTACTCGAACAGCTTCCATCACACCGTTGCAACGCAATTGGTTCAGCACACGCTCGCGC
TCGTAAATCCCTGCCTTGCACAGTTCGTTTGGCTTGAGGCATCGCACGTAGTGCGGGTTAGTCTGATGGAGCGTTTCCAGCAACGTCGTCAGCTGCTCCT
TAAACTGAAGACCGACACTTGCACCTCGGTGCTTACTGGTTTGCGCCCGCTGACGCGGAGAGGATTTGGCGCGGTCACGGGAACCTCCAATGCCCTCGCA
TAGTGTCCGCGCAAAACTGCCTTCTCGAGTGGAATACACGAGCATATCCACAGCCTCCTGGTGGAGAACATCCTTATTCTTCTCTAGGAACCCGTCCGAA
GAGTATTCTACGTGACCCGCATAGTGTACAATCGTAAATAGTCCACGCGCTCGCTGGATTCGGGATGCCTCGAAGCGCGCGTGGCTACCGCAAGCTCGGT
AGAGCTTCGATGCCAGCGTCGTGTCACTTCCTTTCGGCATAACACACTCCTCATCGATGAGCGAAAGGATACCTGTCGGCCGCTGCGAAATTAGGTTCAC
GCAGTCCTGGTTATCGCAGAACTCGATGTACTTCCAGTCCACGCCCTGCGACTCATACTCGCGCTGCTCGGCCTTGAACACGTAGTCATTAAACTGCTGC
TGCAACGTCTCGTTTGCAAAGTTGATGCACAGCTGCTCAAAAGAGTTCTTCGGGAACACTTCGAAGCCGAAGATATCCAAGATGCCGATAAAGTGCAGGC
CGCCCTTCGCCTTCTGGCTGTCGTCCATCTTGAGAAAGTGGTTGATCTTCGTCACCATCCAGTCGAATAATCGGCCGTACAGCGCCTTCGCAAGAGCATC
GCGAGCGTTGTTGGCCTGAGCTGCGGAGAGCTTCATGCTAACAAAGTCTGTACCAGCACGAATTCGGCGTACACTCAGCGCTCGCTCCAGCTTGGTCGCA
TCCACAGCCATGAGCGTGGCTGCCGCATCGCGTGACCAGATGCAGCTCGAAGCCAAGTCCGACTTGCCAGCACCGGGGCCCATCGACTGACCCAACCTGT
CGCTGTTTTCATCGTGCTCGAAGGACAAATTGCCAATGTGCATGAGCGCCGCCAGGATGTCGAAAATACCCGCGCGCTCAGCCGGCGTAAAGCCCACGAT
GTCCATGGCGTCCATAACTCGTCGGAACATGTCCGAGTCTTTGACGCCGTCCCGGCGCTGGTAGCACTCGCTCTGGTTCAGGTAACGGTAGTGCAGGAAC
TGCTGCGTGGCATCCGTGACTTCGCCGTGATCACCAGGAGGCATCGAGTGGCCACTGGGCGGGTCTAGGAACCAGCGCTTACGAGCCGCTGGGGCAGCTC
CGATGGCCATTTCGTAGAAAATGTGGTAGTTCCGCTCGCCCTTGGACTGCGACACGAGACGCACCTTCTCGAGCAAATACGTCTGGATGCTGGCGCCGGT
GAGTCTCCCGCCGCTGGTAAAATGCAGCTTGATAAACTTGCCGAAGCGACTGGAGTTGTCGTTGCGTAGTGTGCGCGCGTTGCCGAACGACTCGAGGAGG
ATGTTGGTCTGCAGCACTTTGGCCGCGATGCCCTCGGGGCTCTTGCCCGCCACGGACGCCGCCAGGTTGTTGGCGCCTACTTGGGCGAGATACTCCATGA
GGAACTTGGTGCTCTCGGTCTTGCCGCTGCCGCTCTCTCCACTCACGAGGATGCTCTGGTCGCTCATGACTCCGTTGAGGCCGAGCATCATGGCCTTGTA
GGCTTCTCCCGCGACTTGGTAGATGTGCGGGGGCATGGGCTCGCTGCCTTTGTTCCTGAGGGACGAGCTGCGCGCCTCGAAGGACAGCAGGTACTTGGCC
ATCGTGTCTTTACTGTAGATGTTGGGGATCTTCTGGAACGGGTTCACAGCCAGCAGGATGGCGCCCGTGTTGGTGTAGATCTTCTGCTGGGCGAAACGCG
TGTCCAAGGCGCTGAGGATCGACGTCTCGTCCAGCTCGATGAGCGTTGTGAGGTCGTCCACGTCCACATCCTGACCCTGAGAGAGCAACCGCACGTCGGG
CGCGTCCTGCGTCAC