Description :
From Genome Similarity Track
Location :
Scaffold_74:100903- 102128
Transcript NameFunction/comments
Aphas_H257_16488Hypothetical protein

Sequence
1225 bases(100 bases per row)
CGCTTTGCCGCCGGTGCCGTTGCATCTGCCTCTGCGGAGATGGCCACACTTCCTGTGGATATCACGAAAGTACGGTTGCAAGCCCAGGGGATGGCAAGTA
CTAGTGGTGGTACCACTAGTGCGTCCGTCGTCAAGTACACCGGCATGCTGGATGCAGTGCGGAGGATCGCGATAGATGAAGAAGGTCCACTGGCGCTTTG
GAAGGGAGCGCAACCAGCCGTGGCACGACAATTCGTGTATTCCAGCATGTGCATGGTGCTCTACGAACCTTTTCGCGATGCCATCACATTGTTCCGTGGC
AACAACAACGACGGCGCCAGCGGCATGTCGTTTGCTCAAAAGCTAATGGCTGGTGGGCTCGCTGGTGCGTTTAGTGTCAGCATTGCGAATCCGTACGTGT
CCTGCCCATGTAACTTGTGAAATCTCTTGACATTCTCCACCAGGGTTGACGTAATTAAAGTTCGTATGCAGGTACCCCGTCTCGTTCAAACTCGTCAGGG
TATCACGCGATTGCTCCATAGGCCGATCGAAGCGGTGTCCTATACAGCGGCATCACGGACGCAGTGGCGAAAATCCATCAACAAGAAGGGTTCCGGGGAT
TTCTTAAGGTAAGTGACAACGATGCGATGCTCGAATTTGATTGTGAATTGGTGCAAATGTGTGTTTTGCATATTGATGCCAGTTGCATTGATATTGACGG
TGCAAAGTGCACTTTGATCCAACGTGGGTTGCGTTGCAGGGCGTGGGTCCAAACGTCACGAGAGGCTTCATCGTCAACGCCGCGGAACTTGGGGTGTATG
ATCAAGTGTACGTGATCACGTCATCGTCTGTCACGATGACATGTCAGGGTTTATGACGTGGCCATGTTAGGAAAACGTCGTTGATTTCGCACGGGATCGT
GGAAGAAGGAGGCATCGGGGCGACGTTTGGGGCGAGTCTCTTTGCCGGGCTCGCGGGGGCGGCGGCATCCAATCCGTACTTGTTGACGTCATCCTCTCCC
ATGTGCTAACGTGATCACTAGCGTGGACGTCCTCAAGACCCGATTGATGACGCAACCAGCTGGCGCGGCGGCGCTATATACAGGCATGTTTTCCTGCGCC
CGCCGCACGTTCCAGGAGGAAGGCGTGAAGGCGTTCTACAAGGGGTTCATTCCCAACTGGATGCGCAAGGCGCCGTGGTGTGTTGTGTTCTTTGTCACGT
ACGAACAATGTCGCGCGATGATGGC