Description :
From Genome Similarity Track
Location :
Scaffold_304:10090- 11494
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_304-fgenesh-gene-0.6Lipoprotein, type 6

Sequence
1404 bases(100 bases per row)
AACGCGTtCTTGTCGGCAGCGTTGAACTTCTTGTTGCTCTTCTTCTTCGGCGAGGCCATGGCTGGCGCAGCAGCCGCAGCCGATGGGGACACAGGCGCCT
CCACTtgCGTCTCCTCCACCTTCTTTGGGCGCGAGGTCTGTTCCTTGAACCAGACcTTCTTGTCCTTGATCGCCTTGAGCGACTCCGTGAGCGCACCCAC
cGTCGATGGTGGCACGAGGCCAATCGTGCTGAACGCGTCGAGCTGCGCCATCTGCAGCGACAGCTTGGCATCGCGCTTCGACTTCTTGACACCCTCCTTC
TTGCCCTTCTTGCCCTTCTTGCCACCGCCAAAGCTCATGAACTCCTCTTCCTTGCGCTGCAGAGGCTTGAGGCCGTCAAGAGtcGCTGGCGCGGCCGACG
AAGCCTCCTCCTTGGCACTCTCAGCCTCTTCCTTGAGCTCCTTGGCGAAGGACTTTTCGAGGAAAGCCACAAGCGCGTCACACAAGTCCATTTCGTCCTG
GTACGGGTGGATCTTGGCCATTTCCTTCTCGTACTCGGCGAGCTTGTTCTCGTACTCCTGACGACGGCGCTCCTCCTCCTTCTTGCGCTCAAGCTCCTTC
TTCTTGCGCACGAGACGGATGTTCTCGTAGTACTTGTCGTTGGCGGCCTTGAAGTCCGCGCGGAGCTGCTTAAGGGCCGTGAACTTCGCGTCGAGCTGCT
CCTTGATCTCCTTGCGCTCCTTGGCCAGCGCTGGGAACTTGTCCTGCTTCTTTtCTTCGTCGTTGAGCTTGTACAGCTCGTCCAGCTTGAGCTTCTGGGC
CGCGAGcTTCTCCTGCACGGCATCGATCTCGGCGTTCTTCTTGGTCTGCTGCGCGCGGATCTCCTTGATCGACTCGTTGTGCTTCTCCACTTCGcTTTtG
TCGTCTGGGATCTTGCTCACCTGGAGCTTCTGCGCCTGGAGGGCTTCAATCTCCTTGATCAGACGCTTCTCCTCGTTCAGCGACATGGAGCGCGTCTCCT
GCTGGTGGCGCAGCGCCGCAATCTCCTTCTCGTACTCGTCCTCGTTCTGGAAGCGCAGGTTCGCACGCAGACTGCGCTGCGTCTTGATCGTCGCGTCCTT
CTTCTCGTGCGTCGACTTGACCTTGGCCGTGAGGGCATTGCGCTGCTGGATCAGGTtATCCTTCTGCGCACGCAGCTCATTGTACACAGCCTTGGCGgCC
TGAaTCTGCTCGCCATATCCGCcACGACCCGTCTTGAGCTTGTCCATCTCAACGCGGATGGCagCCGTGCGGgCCTGCAGGgCCTTGATGTCGGCGTCCA
GCGCCGcGATGGCGGCGTCGTGGGCGGCCTTGTCGGGCTTAGGGaGGCGCTCGATGACGTCTGGGATCTCGATCTCCTCCTCATCCACGACGGGCTTCTT
GGTG