Description :
From Genome Similarity Track
Location :
contig_64:100893- 102737
Transcript NameFunction/comments
g9336.t1hypothetical protein

Sequence
1844 bases(100 bases per row)
GTCCGACTGCCAGTCGGCGACTGGGGAGTTGGTCATTGTCCATTTCTCCAGTTCAGACTGAGAGCGCAGTCGCCGCCGCGTCACTCTGCAGCGGCATGTC
GTCGCCTCTTTTCATCTTGGCAGTGTTCCTCGCAATAACTGCAGCAGCTGAGCACCGCAACACGCTGCACAACTTGCAGAATGAGACGATGACAGAATGG
CCATCATTGCGCTTCCATTTCACCATCAAGCGCGACGCCATGCAAGTTCACGGCCACTCCGAGTTCTCTGTGCTGGCTAACCCTGTTGTGTCCACCAATG
GCGATAACAGTGACAGCGTGCTGTACGACACCTTTGCTACGTTCGAGGAGGACTCGATGATGCACACCTACACACTCGTAGACGGTATCGCGTACGTCTC
CGAGAGCTCTGTGGACGATATCAGCGTTGACCCTTTGGTGAAATGCGTGGAGTCAGGAGTTCTGATTCCAATCAACTCGATCGTGTTGGCACTCAACGAG
GCTGTTCCTGTCTCGAGTATCTCATCGAAAAGTAGCGGAACCATCGAGTGTTCCAGTGGGAACACGTTCAAAGCCACAGTAAACGGTTTTGATCTCGGAT
TGTGTTTCTCGGATTCTTCCGGATTCACGATGTATGGCAACGATATGAATATCGCCGTGGAGTATTTGGAGAGTCGTGAAGACATTGCCGCGCCAACGAT
CAAGAGTGACGTGAAGAATGAGTGCGAAAAAGTGGCGTCGGCTAGCTCAGTGACATCGATCGGGAGGTCATTTCTGACTGGGGCATCGATTTCTCTCGAG
GATACGAGAGAACTGCGAGCTGCGTTCGATTTCGATTTCTCGATTGGTGATGATGATACGTGCTCGTGCAAGTCTACGCCACGCCCATGCATCTTTATCC
ACGGGTTAGGAATCCTCCAAGAGGCGCCGGAAAACCTGGACACGTTCCCTACCAAGTATTGGGGCAACTCGACCGTGACTGCTCATGCTCCATGCTGCTC
GTCAATTAAATTTGCGCTGCTGAATACGATGAATAACTCCTGGACGGACGATGCCCAGCAGCAGAAAGTGTGCGATCGAGTTCTTGCGGTTAGCGAAACC
AGTCAAGGAACTGCAATTTCAGACACCATCATCATCACGCACTCCATGGGCAATCTCATACTGGCTGGTGCAATTGCTTCAGGCAAGTGCAGCCTTGACT
CTAACGTGTCGTGGGTGGGCTTATCAGCGCCAATGCGGGGGTATGGCCTCCAACTACTTCCAGGATTCCTGCAAGAACGAGACGAACGCATATGTCGAAA
AATTAGTGGCGAAGACCGGCTATTGCCCCGCAGACGACGGTATCATCTCTCTTGCGTACGAGGGAGACGAATACAGCTCTACCGAACTAGATGCAGCGTA
TGCGGCTGCGCAGCAGGTTTATCGGCGACACGTGACAGCCGTAATGTGCAGCGACGGGTTTTCCGGCCTGCGGTCAGATCGGCAATGGTGGTATTGGTGC
TAGGCATCGTCATCCCCAATAAATCCTTCGACAGCGATGGCATGGTGGAGCTCGATAGCTCGCCGGTGGATTCTCCCATTTAATGTTTGGAGACACCTAC
AAGGATCGATTCTACGTGACAAAACTCAACCACGCAGACACAGCGTTCCGGAATGGCGACGCACTCTTCAATAAGGCAAAAATGCCTGTGAAGTGGTTCG
AGTGTCTTCTGTAGTTGACAGCTAAAGGATAAAGCAACAAGAAGATAAAATTATTATGAAGCTCGCGGATTTTCGTTGGGTTTTGCTTTGGGAGGGGGGG
GGGAGGAAAACATCTTCACATGTCAAGTCGTGATCTGGATATGC