Description :
From Genome Similarity Track
Location :
Scaffold_194:10088- 16884
Transcript NameFunction/comments
Phyag_g3309glycosyltransferase

Sequence
6796 bases(100 bases per row)
ACCAGGCTCGCGCGTGACTGGGGAACTGCAAAGAGACAATGGCGATGACGCCTGGTGGCAGCAAGATGGACCGACGTCGAGCCGGCTCGAACTACTTCCA
ACTGGATGCAGACCGCAAGCGCAACACGTCGGCGAATCGCAGCCATTTGAACCACGGCGACGGCCGCGGTACCTTCGGAGACCGACTCAGCATGATGGAC
GTGTTACCCCCCACCCAAGGCAACCAGATGCGCGGCGGAGGACTCGAAGGAGACTTTGCAGACGAAGTGTCCATTGATTTCTGCTGCGAGGTGCTGTACA
ACAAGTTCGGCTTCCAGTCGGGCTCAGTAGACAACCAGCGagagcacgtgctgctgctgttggccaATTCCAAGGCGCGGTCGAAACCCCAAGACCCCCC
GGGACACCAcgtcgtgacgctgcacaagaagctcatgagCAACTACACCGAGTGGTGCCAATTCATTGGCGTCCCCAGTGTCACGTACACGGGCCAGCCG
CAGGGAGACCTCAAGAACCCATTGCACATGGACATTAtgctgtttctgctgctgtggggCGAAGCTGGCAACTTGCGTCACATGCCTGAAAGTTTGTGTT
ATCTGTACCACCAGTCGCTGAATATGCTGAACCAGGACTTCCTCGGCCAACAAAAAGTGCCGGAAGGTTGGTACTTGAGGCAGGTGGTGCGTCCGATCTG
GAAGGAGGCGAGCAACATGCAGCGCAAGAACAGTCTGGGCAAGAATCTGGAACACACTCAGGTGCGCAActacgacgacatcaacgAGTACTTCTGGAAG
AAATACTGCCTCAATATCGACATTACCCACATCGGAGAGGAGCTGACCAAGAAACACACCAAGACGTACTACGAACACCGTAGTATTTTCACATTGGTAC
TCAACTACTACCGCATCTTCCAGTTCAACATGATGTTCATGATGGTGCTGATGGCTATTGCCTTCATCTCGGCCATCTCGCCTAGTGGTGGGCAGCAGTG
GTTCGCTCAATTCGGATCCATGGGAGAAGTTGTCGAGCCttaccagcagcaggatgtCAAGTTGACGTACGTCGGTATCGTGTTTACCTTGTCCGCTATG
GGATTCTGCAAGACCGTCCTTGAAGCGTGTCACGGTTGGCACTTGCTCATTGCCAGCGAGTCGTCTGAGACGTCGTCACGTTCGTTCAACTACGGTGGAG
CTTTGGTGGTTCGTATGCTCTGGAACGGAGCCTTTGCTGGCATCTTCGGTTTGATGATCTACACGCCGTTAATTACCAGCAAGAAcactgagctgctgga
caaggcgGCGCCGGCTTCGGTTGCTTACATTCTGCCTGGTGCGCTGATCATTGTCGTCCAAGCTTTTTCCCCATCGATGATCACGAAGACGTTCGCTGCT
AAGTTCATCCGTGAAGGTGAAACGTGCTACGTTGGACGTAACATGACGCCCCCGTTGAGCTACCAGATCAAGTACATCACCTTCTGGTTGGTGCTGTGGG
CGCTCAAGGCGTTCGTGTCGTACTTCATTCTGGTGCGTCCTCTGGTCCTTCCGTCGCTTGCCATCTACGAGATGGAGCTCGAGTACGGTAGCAACGTGGT
GTCGTTCCACAACTTCGGTGTCATCGCTGCTCTGTGGATGCCTGTGATCTTTATTTTCAACTACGACACGCAGATCTACTTCACGGTGTTCCAGGCTTCG
CTTGGTGGCATGCAGGGTCTCATCATGAAGACAGGTGAGATTCACGGTATCAAGGAGATCACAAAGGCCTTCCGTGTGGCTCCTCAGCTTTTCGACCAGA
AGGTTGTGACCAATCTCGCCCGCTCCAACGATGCCGCTGCTGATGGATCTGCCGCTGCGTACCAGTCGCAGATGATGCTTCGTTTCGTGGTTGTGTGGAA
CGAAATTGTCAACTCATTCCGTGAAGGGGACCTGGTGGATGACAAAGAAGCTGCTATCCTCCAGTACGACATTCAAAGCTCAGGCGACGTGTTCGAGCCC
GTGTTTCTGTCTGCGGGTAAGCTGGTGGAAGCTCTCGACTACACGGTGAAACTGGCCAAGGAAGGCAAGGGCGACTCGCAGCTCCAGGTGTACATGGTGC
AGAAGGATTGTCTGTCAGCtgtgcgcagcttcttcacggccAGTATGTACGTGATGGAGGCTCTACTCGGCAGCGATGATGCCGATGTTCTTGATGCGCT
TCGTCAAATGGAAACTATTGCTGCGAACGGCAGCTTTATGGGTACGTTCGATGCTAAGAGCTTGGTGCAGTTGCGTACTGTGTCGATGGAGTTCTTGGAA
GCTGTGATGGACCTGCCGGACCCGGATGCTCAGTCCTCGCACTTGACGAATTCCAGAGTGCACACGATGGGTGTTGTGCGCAACTTCGTgaccaagatgg
agaactTGCTTAACGCTATTCGCATCTTCGCGAACCGCCCTGAGCTTGCTGCCAAGTTCAGCAACGCGAagttctgctccagcgcgAACGGTTAcgtgtt
tgctgctcgtggctTGGTAAACCTGTTCCACAACGACACGGCTATGGGTGCTGCAACGCGCGCCTACCTGTTGATGTCTCTCGAGAAGGCCGACGCTATG
CCGCGTGTTCCTGAGgcccagcgtcgtcttggtttcttcatgaagtcgCTTCTGATGGACATCCCGCAATTGACGTcggtgaaggagatgcaCTCGTTCT
CCGTTGTGACCCCGTTCTACAGTGAAAGTGTGCTGATCTCGTTGTCGGAGCTGAACGACCCGTTGGTGAACCACCCTGTCTTCCAGAAGGTTgaggagaa
gggcaagaacATTACCATTCTGAAGTACCTGATCACGATCCACCCTGAAGAGTGGGAAAACTTTTTGGAACGTATCGATGTGAGCACTGCCGAAGAAGCG
CAGGCGAACTACCCGCTGGAAATTCGTCTGTGGGCTTCGTACCGTGGTCAGACACTGGCGCGTACCGTTCAGGGTATGATGTTGTACGAAGATGCCATCA
AGATCCTGCATTGGTTGGAGATTGGTTCAAGCCCTGGCAAGACTGCCGAGCAGAAGCAAGCTCAGTTGGAAGACATGGTGCGCTTGAAATTCTCGTACAT
TTGCGCTTGTCAAGTGTACGGTAAGCATCGCGCGGAGAACAAGGCCCAGGCTGATGACATCGACTACCTATTGAAGACGTACCCGAACTTGCGTGTGGCC
TACGTTGATACCATTGTGACCGATGGTGGCAAGCAGTTCGACACTGTGCTTATCAAGAGCGAGGGCAACGAAATTGCGGAGGTGTACCGCTACGAACTGC
CTGGTGATCCGATTCTTGGTGAGGGTAAGCCAGAAAACCAGAACAACGCTCTTCCGTTCACGCGTGGTGAGTACCTGCAGACTATTGATatgaaccagca
gcactaCTTCGAGGAGTGTCTGAAGATGCCCCAGCTTCTCGTGACTGCTGACCTGCACCCGTCGAAGAAGCCTGTGTCGATCATTGGTATGCGTGAGCAC
ATTTTCACTGGTAACGCTTCGTCTCTATCGAAGTTCAAGTCgtggcaggagctggtgttcGTGACGCTATCGCAGCGTGTGCTGGCTGACCCACTTTACG
TCCGTATGCACTACGGTCACCCCGATATTTTCGACAAGGTTATTGCCATGCCTCGTGGTGGTGTGTCCAAGGCCAGTAAGGGCATCAACTTGTCTGAGGA
TGTGTTCGCTGGTTTCAACTCTACTCTTCGTGGCGGTGTGGTGACGCACGTGGAGTTCATGCAGTGTGGTAAGGGTCGTGATGTGGCTCTTTCGCAGATT
TCCATGTTCGAAGGTAAGCTTGCCAACGGTGCAGGTGAGACTTCGTTGGCACGTGAGGCTCACCGTATGGGCCAGTTCATGGACTTCTTCCGTCTTAACT
CGATGTACTACTCGCACACGGGCTTCTACTTTGCGACGTGGATGACCATTGTGACGACTTTCgtctacatgtactgcaAGGTGTACCTCGCTTTGGCtgg
cgtgcagcagcagattgtgTACGACATGAACTCGACTGCTGTGATCACTGACAATATCgccaacaacttcgacgagcgTGTATTCACGGACCTGAAGGCT
GTGCTCAACACGCAGTTCTACATCCAGGCCGGTTTCTTCCTCATGCTTCCGCTGATGTGCGTGTACTTCGGTGAAGGTGGTTTCGTGCGTGGTATGACGC
GATTCATCGATATGATCATCACGCTCGGCCCTGCCTTCTTCGTGTTCCAAGTCGGTACGACGATGCACTACTTCGACAACAACGTTGTGCACGGAGGTGC
CAAGTACCAGGCTACTGGTCGTGGCTTCAAGATTTCTCGAGAAACGTTAGTGTTATTGTACAAGGCGTACGCGAGTTCACATTACCGGAAAGCCTGGGAG
CTCATGGGTTTGTGTCTTGTGTACTTGGTGTTCGGTAACTTCTACATCTGTCAGACCGATGCGTCCGCCAACGACAACACTTTCGCGTCCGACTACTGTG
ACACTGCTCAGGCTTACGGCGTGCAGACGTTCTCGGTGTGGTTCATTTCCATTCTGTGGGTCATTGGTCCGTTCCTGTTCAACAGTGATGGTCTCGACTT
taagaagacgaaggtggaTATCCAGCAGTGGTGCATGTGGATGTTTGCTGAGGAGGactacaaggacgacgacccgGCGAACAAGGGTGGCTGGGTTGGT
TGGTGGAAGGGTGacctggagcagcttcacaaCTCGAACATGATCTCGCGTGTCACCGTCATCCTTCGTGAATGCCGACACTTTTTGTTGATGTTCTACG
TGGCTACTCTTGAGACGTCTGATGTGATGTACGTCGCGTACTCgttcggtgctgctgttgcgacGGTGATTCTTCTGGGTGTATTCCACGGTGTTGGCAT
GGGCATGCGGTCCATGAGCCCTGTCACACGCGCATCGCTCTACTTCTTTACCATGGCTGCGTTGGTTACAGCGTACTTCCTGGCCACTTGGATTGTCTTG
GATTGGAAATTCAAGTACTCGATttcgctcttcttcgcctaCGTCGCTGCGCTTTACGGCATCAACGAGTGCTTCCGCATGTGGAGCTTCCCGCACTCGT
CGATTGCTGGTATCCCTGtgttccagcagctgcagttcctgttcgacttcatcttctgcacgGGTATGATCATCccgttggtggtgatgtcTTGCATTCC
GTTCTTGAACGTTATCCAGACGCGTATGATGTACAACGAAGGCTTCTCCAAGGTcatgtcggcgtcgtcgcagtACGCGTTCTCGTTGGCAGCCTTTATG
GGCGTTTTGGgtggcgttggtgttggttggctgttcaacttgctgtcgacgctggagcagtcGGCAAGTTTTGCGAGTTACGTGGTGACGTACGATGGTG
TGCTCAGTGGCAACGTCGGAGACGGCACAACCACGTACATGCTGTATGGTGCGTGTGTCGTGGGCACGATCATCGCTGGTTTCTTGAACTACTTCCTGGG
CCGTCGTTTGTCTATTGTGGCTGGTGGTCTCTTCAGCACGCTGGGTATGGTTGCTGTCAGTGCCAACGACGACCTTCGCAAAACCCTGCTCATGCCTGGT
ATCGGTCTGCTTGGAGCGTCGTGTGGTAtcctgctgccgtcgctggcgatTTACATCTACGAGATCTCGACGAAGGAGATGCGTGGCAAGGCCATCTTGC
TCCTTGGTGTGGGCTTCATTGCCGGTAGCTTGCTTGGTGGCATCTTTGCCACTGTAAACCAGTTGGGATGGATCTGGCAGGTATTCGCTGCTTGTATTGT
CATTGCACTGGTGACTCCAGTGGTCAACGTTTTCCCGGAGAGTCCGTACTGGGTGTTGGAGCGTAAGGGCTGGGACGCGTGCGAAGCCTGTCTTGTGATT
CTGCGTCGTAAACCCGATGTGCAtgaggagctcaagatcatGCGTGAAGAGGAGACTGCGGACGAGGGTGGTGCAGGCGCCTTCAAGTTCCTAATTGGTT
TGTTTTTGATGCTCGTGTCGTCGCTGACCACGGGTTTCCTGAACGCTTTCGTGAGCTACAAGGGCGCGAGCGAGTACACCGATCAGGACCAGTTGTTCGT
CAACGCTATGGCACTGCAGATCTCGGGTGCTGTCATCGCCTTGTTCTTCATCGACAAACTGGACCACAAGTCTATTCTGTTCGGAACGTTGATCCCTGTG
GCGATTTGTGCTGGTGTGTTGGGCTTCAATGAGTCGTCCAAGTTCCTGGGTGACACAGAGGGATCCGGTCTGTACGTGAGTCTGGTCGTCATGCTCATGT
ACTTTTTCATGGGGTTGGGCACAAGTTCTGCCCCGTGGTCGGCCTGTGTGGGCATGTTCACGACCCGCGGCCGCGCATCGAATACGACGATGTtgttcgc
catcttcttcctggcaGACCTGGGCTACGTCTACATGCACACGCATGACTCGCTCATGGAGAACGAGTACTTGTACCTCTACGCGATCGCAGGCTTTAGT
GTCGTGGCGTTGGTACTACTGATCGGAGCgggcaccaagaagaacggtGTCATCTGTACCAAGTCGGAAGCCGAGCGGGACCGCGATCGCTACGCTCGGA
TGCGGGCGGAGCGCGCAAGTCGCAACACGCGGACGCCAGGCAACGCGCGTCAACGGAACCTCAGCAGAGTGCGGTCCAAGTCCAATGCAGGCGGCCAGCG
AGGCAACGCCACGCCAGCAGCTGGCTACCAAATGTACGAAACTCCTGCGAATGCTGCGCCGCCGCTCATGCACGCACGTGCCTAGAGGATCGACAA